ID: 1027806509

View in Genome Browser
Species Human (GRCh38)
Location 7:82832175-82832197
Sequence CAATACATAAAGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027806509 Original CRISPR CAATACATAAAGATGGGACA TGG Intronic
901016961 1:6237360-6237382 CACTACCTAAAGATAGGCCAGGG - Intergenic
902721707 1:18308554-18308576 TAATCTATAAAAATGGGACATGG - Intronic
905421986 1:37853429-37853451 CAATACATAAAGAATGAACATGG - Intronic
906386486 1:45373252-45373274 CAAGACATAATGATGGCAGAAGG + Intronic
908968317 1:69794175-69794197 CAGAACATAAACAGGGGACACGG + Intronic
911663289 1:100527449-100527471 GAATACAAATAAATGGGACAAGG + Intergenic
917035186 1:170740994-170741016 GAAGACATAAAAATGGGACTTGG + Intergenic
917422266 1:174876831-174876853 CAAAACATAAAAATGAAACAGGG - Intronic
918154878 1:181835392-181835414 CAAAGCATAAAAATGTGACAGGG + Intergenic
918402690 1:184179545-184179567 CAAAACATACAGATGTCACAAGG - Intergenic
918730826 1:187994046-187994068 CAATACATATCAGTGGGACATGG + Intergenic
919087026 1:192932607-192932629 ACATTCATAAAGATGGCACAAGG + Intergenic
921786943 1:219242605-219242627 CAATACACAATGATGGAACAGGG - Intergenic
922059842 1:222078006-222078028 CATTACATAAGGATGGAATATGG + Intergenic
922665147 1:227462395-227462417 CAATGCACAAAGAAGGGCCAAGG + Intergenic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1067304029 10:45042324-45042346 TATTACATAAAGAGAGGACAGGG + Intergenic
1071370361 10:84945055-84945077 TCATACATACAGATGAGACAAGG + Intergenic
1075235350 10:120722908-120722930 CAATAGAGAAAATTGGGACAGGG + Intergenic
1078121194 11:8510761-8510783 AAAAACATAAAGTTGGGAAAAGG - Intronic
1078665867 11:13324667-13324689 AAATCCATGAAGATGGGACCTGG + Intronic
1079461472 11:20683097-20683119 GAAGACATAAAGAGGGGAAAGGG - Intronic
1079640956 11:22804820-22804842 TAATAGATAAAAATGGGAAATGG + Intronic
1080038582 11:27735180-27735202 AAATAAATAAAAATGGGACGTGG + Intergenic
1082629950 11:55530183-55530205 GAAATCATAAAGATGGGAGATGG + Intergenic
1083784170 11:64934323-64934345 CAATAAATAAAAAGGGGACAAGG - Exonic
1085677744 11:78540627-78540649 GAATACATAAAGATGAAGCATGG + Intronic
1086027157 11:82308009-82308031 CCATACATAATAATGGGAGACGG + Intergenic
1086401397 11:86463586-86463608 CAAAAGAGAAAGCTGGGACATGG - Intronic
1086613524 11:88786631-88786653 GAAGACTTAAAGATGGGGCAGGG - Intronic
1087861999 11:103170168-103170190 CAAGCCATGAAGATGGGACTTGG + Exonic
1088231188 11:107675224-107675246 AAATACATCAAGATGGAACAAGG + Intergenic
1088416343 11:109593259-109593281 ACATAAATAAACATGGGACATGG - Intergenic
1089583213 11:119494550-119494572 CAAAACATAGAGGTGGGCCATGG + Intergenic
1091128599 11:133124393-133124415 CAAGCCATAAAGATGGGTCTAGG - Intronic
1091185994 11:133648447-133648469 CAACACAGAAAGATGGGGAAGGG + Intergenic
1092515829 12:9211715-9211737 CAGTCTATAAAGATGGGAAAAGG - Intergenic
1093853572 12:24070558-24070580 CAATAAATAAAGATGAAAAAGGG - Intergenic
1094003976 12:25727431-25727453 CAACACATAAAGGTAGGTCAAGG + Intergenic
1096284421 12:50285927-50285949 CAATACTTAAAGAATGGGCATGG + Intergenic
1097531367 12:60804550-60804572 CAATAAAATAAGATGGGGCAAGG - Intergenic
1101802014 12:108030699-108030721 CAAGAGATGGAGATGGGACAGGG + Intergenic
1102334701 12:112068260-112068282 CCATAGATAGAGATGGGAGAGGG + Intronic
1104551815 12:129764034-129764056 CAATACTCAAAGCTGGGGCATGG - Intronic
1107374149 13:39784102-39784124 TAATACATTAAGAAGGGATAAGG + Intronic
1108318601 13:49263556-49263578 CACTACATAAAAATTTGACAAGG - Intronic
1109231179 13:59759282-59759304 AAATACATAAGGATGGGCCCGGG + Intronic
1111906766 13:94264334-94264356 AAATAAATAAAGATGTGACAAGG + Intronic
1111986732 13:95073721-95073743 CAATACTTAATAATGGAACAAGG - Intronic
1113007447 13:105723122-105723144 CAGCACAGAAAGATGAGACATGG - Intergenic
1113452555 13:110421809-110421831 CAAGAAATAAAGATGAGAAAGGG + Intronic
1113521877 13:110947225-110947247 CAATGCTTTAAGAGGGGACAGGG + Intergenic
1113706016 13:112433474-112433496 CAATGCTTTAAGAGGGGACAGGG - Intronic
1115518380 14:34208193-34208215 CAAGACAGTAAGATGAGACAGGG + Intronic
1116031351 14:39576682-39576704 CCATACACAAAGGTGGGAGATGG - Intergenic
1116367632 14:44087510-44087532 TAATAAATAAAAATGGGGCAAGG - Intergenic
1119886108 14:78144167-78144189 GATTACATAATGATGAGACAGGG + Intergenic
1120983285 14:90310243-90310265 CCATGCAGAAAGATGAGACAGGG - Intronic
1123680057 15:22756733-22756755 TAAGACAAAAAGATGGGTCACGG + Intergenic
1124332269 15:28831186-28831208 TAAGACAAAAAGATGGGTCACGG + Intergenic
1126279544 15:46928589-46928611 CAATACATGTACATGGTACAAGG - Intergenic
1126633277 15:50758485-50758507 AAATACAAAAAAATGGGCCAGGG - Intronic
1127070150 15:55281146-55281168 CTATACATGAAAATGGCACAGGG - Intronic
1129628673 15:77233565-77233587 GAATGGATAAAGATGGGAAAAGG - Intronic
1131899365 15:97070992-97071014 CAATACATTAATGTGGAACATGG + Intergenic
1131926767 15:97393094-97393116 TAATACACAAGGATGGGATAGGG + Intergenic
1134275559 16:12772880-12772902 CAATACTTCAAGCTGGGACTCGG + Intronic
1134655580 16:15946163-15946185 AAATACAAAAAGGTGGGCCAAGG - Intergenic
1137322184 16:47396366-47396388 CCATACATGAAGATGAGAAAGGG + Intronic
1138635157 16:58332334-58332356 AAATCCATAAAGAGAGGACAAGG - Intronic
1140654317 16:77123976-77123998 CAATACACAAAGAAGGGAAGGGG + Intergenic
1141207328 16:81942950-81942972 CAGTGCATAAAAATGGGACTTGG + Intronic
1149262672 17:54896827-54896849 GACTTCATAAAGAAGGGACAAGG + Intergenic
1149954774 17:61036428-61036450 AAAAAAATAAAGATGGGATAAGG - Intronic
1151235302 17:72715692-72715714 AAATAAAAAAAGATGGTACATGG - Intronic
1151508240 17:74543160-74543182 CAGTACCTAGGGATGGGACAAGG - Intronic
1151925565 17:77193683-77193705 CTATACCTAAAGATGAGGCAGGG - Intronic
1152184104 17:78843368-78843390 CCATCCATGCAGATGGGACAGGG + Intergenic
1152445939 17:80343655-80343677 CTAAACATAAAAATGGTACAGGG + Intronic
1153573472 18:6496733-6496755 AAATACAGAAAGAGGGGAAAAGG - Intergenic
1155292845 18:24358614-24358636 CAATACATAAACATGAGAAATGG + Intronic
1155768348 18:29666469-29666491 ACATACATAAAGATGTGCCATGG + Intergenic
1156027402 18:32670338-32670360 TAATAAATAAAGAAGGGAAAGGG + Intergenic
1159516455 18:69464967-69464989 CAATATGTAAAGATGCTACAAGG - Intronic
1160612673 18:80100745-80100767 AAATCCGTAAAGATGGAACATGG + Intergenic
1160628129 18:80227313-80227335 CAAAACAGAAAGACAGGACAAGG + Intronic
1163291395 19:16381568-16381590 CACTAGATAAAGTTGGCACATGG + Intronic
1164869430 19:31630955-31630977 GAATAGATTAAGATAGGACAGGG - Intergenic
1166442488 19:42826968-42826990 CATTACATAATAATGGAACAGGG - Intronic
1166838922 19:45684323-45684345 TAATCTATAAAGTTGGGACAAGG - Intergenic
1168085908 19:54046605-54046627 GAATGCATAAAAATGGGAAAGGG - Intronic
1168611269 19:57802524-57802546 CAAGACATTAAGAAGGGGCAGGG - Intronic
925816282 2:7754061-7754083 CTATACATGATGATGAGACAAGG - Intergenic
934996948 2:98972158-98972180 CAATACAGAAATATGTAACAAGG - Intergenic
936100106 2:109569959-109569981 CACTACATAAAGATGAGAGGTGG - Intronic
937604321 2:123778892-123778914 CAATACACAACGATGGGACAAGG + Intergenic
938440344 2:131325436-131325458 AAATAGATATACATGGGACATGG - Intronic
939710223 2:145508309-145508331 GAAGACATAAAAATGGCACATGG - Intergenic
942210264 2:173663153-173663175 CAGGAGATAAAAATGGGACAGGG - Intergenic
942257559 2:174119683-174119705 GAACACATAAAGATGGGAAAGGG + Intronic
945131610 2:206579493-206579515 CAAAACATAAAGTGGGGAAAAGG - Intronic
945237837 2:207648904-207648926 AAACACTTAAAAATGGGACAAGG + Intergenic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
946785025 2:223234746-223234768 CTATACGTAAAGGAGGGACAAGG - Intergenic
946915723 2:224518844-224518866 CTATGCTTAAAGTTGGGACAGGG - Intronic
1170920694 20:20676934-20676956 CAATACATAAATAATGGATATGG + Intronic
1171026793 20:21638093-21638115 AAATAAATAAAAAGGGGACAAGG - Intergenic
1172250362 20:33475242-33475264 CAATACATAACGACACGACACGG + Intergenic
1172270974 20:33655688-33655710 TAATAAATAAAGATGGCAGAGGG + Intergenic
1173347371 20:42213372-42213394 CAATACACAGAGAGGGGAAAGGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1179394682 21:41028016-41028038 GACTCCATAAAGATGGGAAAAGG - Intergenic
949494705 3:4620587-4620609 CAATAAATAAAGATGGAAAGAGG - Intronic
950444718 3:13029956-13029978 AAATAAATAAAGGTGGGACGAGG - Intronic
953229430 3:41051548-41051570 CGAAAGATAAGGATGGGACAAGG - Intergenic
953371889 3:42395765-42395787 CAATACCTAAAGATCTAACATGG + Intergenic
954467243 3:50662958-50662980 TAATACACAGAGACGGGACATGG - Intergenic
955131561 3:56174675-56174697 CACTTCAAAAAGATAGGACATGG + Intronic
955476770 3:59344932-59344954 CAATACATATACATTTGACAAGG - Intergenic
956523360 3:70130089-70130111 CTATTCATAAAGAGGGGGCATGG - Intergenic
957033258 3:75267400-75267422 CAATACAAAAAGCTGGGAAGGGG - Intergenic
958914699 3:100036062-100036084 CAATGTATAGAGATGGTACAGGG - Intronic
960635832 3:119783320-119783342 CAATACATAACGAATGGGCATGG - Intronic
965284922 3:166806318-166806340 GAATACATCAAGATGAGAAAAGG + Intergenic
965883423 3:173414295-173414317 GTATACAAAAAGATGGGAAAGGG + Intronic
967465731 3:189804064-189804086 AAATACATGCATATGGGACATGG + Intronic
967983954 3:195081712-195081734 CAATACATTCAGATGAGATAAGG + Intronic
970781792 4:19746336-19746358 CAGTACACAAATATGAGACAGGG - Intergenic
974356724 4:60821977-60821999 CAATCATTAAACATGGGACAAGG + Intergenic
974357180 4:60827548-60827570 CAATTCATAAAGATGGTTCTTGG + Intergenic
976321988 4:83726737-83726759 CAAAAAATAAAGAGGGTACATGG + Intergenic
976720604 4:88165503-88165525 CAATACTTAAAGGTGGAAGAGGG - Intronic
977230775 4:94449880-94449902 CAATACAAATAGCTGGGACCTGG + Intergenic
978873684 4:113611259-113611281 CAATAAAGAAAGCTGGGCCATGG + Intronic
979253432 4:118588520-118588542 AAAGCCATAAAGATGGAACAAGG - Intergenic
980731467 4:136829881-136829903 AATTACATAAAGTTGGGAAATGG + Intergenic
980901768 4:138911744-138911766 TAATACATAAGGCTGGGACCAGG - Intergenic
985688043 5:1292431-1292453 TCATACCTAAAGATGGGACCAGG + Intronic
986391014 5:7288481-7288503 CAAAACAAAAAGATGGGTCACGG + Intergenic
987614844 5:20260301-20260323 CAATTTATAATGGTGGGACAAGG - Intronic
987926015 5:24342869-24342891 CAAGATATAAAGATGGGGCCGGG + Intergenic
989825011 5:45843160-45843182 CAATACCTAAAGATGGAATTGGG - Intergenic
990238681 5:53795128-53795150 AAATACATAAAGACAGGAAATGG - Intergenic
990624659 5:57597767-57597789 AAATACAAAAAAATGAGACAGGG + Intergenic
990773709 5:59281256-59281278 CAATACATAAAGATAGAAGTAGG - Intronic
991083704 5:62628309-62628331 CAGTACATAAAAAGGGGAAAAGG + Intronic
991111597 5:62905850-62905872 CAATCCATAAAGATGGAATTTGG - Intergenic
992875556 5:81051093-81051115 CAATACCAAAAAATGGGAAAAGG - Intronic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
993602660 5:89947570-89947592 AAATACATAAAGCAGGGAGAAGG + Intergenic
994467404 5:100155508-100155530 ATATACATAAAGTTGGGTCATGG + Intergenic
995317568 5:110793425-110793447 AAAAACATAAAGTTGGGAAAGGG - Intergenic
995921292 5:117317141-117317163 CAATTAATAAAGAAGGGAAAGGG - Intergenic
995970054 5:117957558-117957580 CAATCCATGAAGTTGGGACGTGG - Intergenic
996920685 5:128764380-128764402 CAAGACATAAAGATGGCAAATGG + Intronic
999061946 5:148645317-148645339 CAATACATAAATGATGGACATGG + Intronic
999624396 5:153505023-153505045 CTATACCTGAAGAGGGGACAGGG + Intronic
999627873 5:153539107-153539129 AAATACATGAAGATAGGAGAAGG - Intronic
1000986996 5:167871764-167871786 CAGTACATAAAGTGGGAACAAGG + Intronic
1002694469 5:181075302-181075324 CAATAGAGAAAGACGGGACGAGG + Intergenic
1004893628 6:20125446-20125468 CAAGACATACAGCTGGGAAAGGG - Intronic
1007710851 6:43823171-43823193 CAATAAAAAATGATGGGACAAGG + Intergenic
1007733624 6:43966793-43966815 CAGTAAGTAAAGATGGGACAGGG - Intergenic
1008610510 6:53180902-53180924 CAATACAAAATGAATGGACATGG - Intergenic
1009438595 6:63648001-63648023 CAATACTTAAAGTTGGGAATAGG + Intronic
1010823886 6:80449500-80449522 TAATACATAAAAATGAGGCAAGG + Intergenic
1012663807 6:101940451-101940473 TAATAAATAAAGATGGGAACAGG - Intronic
1014539886 6:122662632-122662654 AAAAACATAAAGATGAGGCATGG + Intronic
1014670061 6:124291889-124291911 CAATAGATAAACAGGAGACAAGG - Intronic
1016897993 6:149072793-149072815 AAATTCATAAAGATAGAACATGG + Intronic
1017381360 6:153835063-153835085 GAATACATAAAGAAAAGACAGGG - Intergenic
1018137470 6:160791519-160791541 CAAGACATTAAGACGGGGCAGGG + Intergenic
1021889673 7:25175233-25175255 CAATACAAAAATAGGTGACACGG - Intronic
1025723206 7:64035113-64035135 CATTACCTAAAGAGGGAACAGGG + Intronic
1027806509 7:82832175-82832197 CAATACATAAAGATGGGACATGG + Intronic
1028856599 7:95600145-95600167 CTATACATTAAGATAGGACAAGG + Intergenic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1033808550 7:144982544-144982566 CAATATGGAAAGATGGGGCAGGG - Intergenic
1036836209 8:12070672-12070694 ATGGACATAAAGATGGGACATGG + Intronic
1036858051 8:12317241-12317263 ATGGACATAAAGATGGGACATGG + Intergenic
1037867463 8:22457307-22457329 AAATAAATGAAGATGGGACTTGG - Intronic
1039196200 8:35034462-35034484 TATTACATAAAAATGGGAAAAGG - Intergenic
1040098664 8:43476511-43476533 TAATACATATAGAAGGCACAAGG + Intergenic
1040806603 8:51403483-51403505 CAAAACATTAAGATGCGCCAGGG - Intronic
1045073354 8:98534897-98534919 CAAACCATAAAGCTGGGAGAAGG + Intronic
1046134575 8:110010190-110010212 TAATACAGAAATATGGTACAAGG + Intergenic
1047033622 8:120911476-120911498 CAATAGAGAAAGAAGGGAGAAGG - Intergenic
1047077956 8:121425482-121425504 AAATGCATACAGATGGGAAAGGG + Intergenic
1048564123 8:135576376-135576398 CAATAGATAAATAGGGGAGAAGG - Intronic
1051500805 9:17775793-17775815 CAGAACATAAAGATGTGACTTGG + Intronic
1052684624 9:31739672-31739694 AAATACATTAAGACTGGACAGGG - Intergenic
1055930876 9:81558828-81558850 GAACACATGAAGTTGGGACAGGG - Intergenic
1056530854 9:87486173-87486195 CAATCCAAAAAGAGGTGACACGG - Intergenic
1059889174 9:118782213-118782235 CAATACATGAAAATGAGATAAGG + Intergenic
1060913570 9:127370178-127370200 CATTCCAAAAAGATTGGACATGG + Intronic
1061938849 9:133873363-133873385 CAAGACATACAGATGGCAAAGGG + Intronic
1185592585 X:1287440-1287462 CAAAAAATAAAGGTCGGACACGG - Intronic
1187567349 X:20464626-20464648 AAATAAATAGAGATGGGAAAAGG + Intergenic
1189087602 X:38042572-38042594 CAATACACAAGGAAGGGAAAGGG - Intronic
1189655348 X:43239189-43239211 AAATTCATAAAAATGGGATATGG + Intergenic
1193241393 X:79174301-79174323 CAAAACATATTGATGGGATAAGG - Intergenic
1193920604 X:87421043-87421065 AAATAAATAAAAATGGGAAAGGG + Intergenic
1194156977 X:90403090-90403112 CAATGAAGAAAGATGGCACAAGG + Intergenic
1194890851 X:99376576-99376598 CAAAATATAATGATGGGATAGGG + Intergenic
1195707099 X:107745137-107745159 TATTTCATCAAGATGGGACAGGG - Intronic
1199096721 X:143751497-143751519 GAAAACATGAAGAAGGGACAAGG + Intergenic
1199417638 X:147604276-147604298 AAATACATAACGATGGGAGATGG + Intergenic
1199581232 X:149362465-149362487 CAAAACAAAAAGATGGAAGAAGG + Intergenic
1199656065 X:149996616-149996638 CAATACATTGAGATGGGATATGG - Intergenic
1200503315 Y:3980064-3980086 CAATGAAGAAAGATGGCACAAGG + Intergenic