ID: 1027808550

View in Genome Browser
Species Human (GRCh38)
Location 7:82861805-82861827
Sequence AGAAATAACCAGAGGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027808548_1027808550 12 Left 1027808548 7:82861770-82861792 CCAAGTATTTTCTCTTACTACAA 0: 1
1: 0
2: 8
3: 51
4: 410
Right 1027808550 7:82861805-82861827 AGAAATAACCAGAGGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027808550 Original CRISPR AGAAATAACCAGAGGAATTT TGG Intronic
No off target data available for this crispr