ID: 1027809757

View in Genome Browser
Species Human (GRCh38)
Location 7:82880592-82880614
Sequence ACCAAAAATGTTTCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 4, 2: 34, 3: 101, 4: 392}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027809757_1027809759 2 Left 1027809757 7:82880592-82880614 CCATGTCTAGAAACATTTTTGGT 0: 1
1: 4
2: 34
3: 101
4: 392
Right 1027809759 7:82880617-82880639 TCACCGTGGAACGATGCTACTGG 0: 1
1: 0
2: 0
3: 1
4: 31
1027809757_1027809763 24 Left 1027809757 7:82880592-82880614 CCATGTCTAGAAACATTTTTGGT 0: 1
1: 4
2: 34
3: 101
4: 392
Right 1027809763 7:82880639-82880661 GCATTTAGTGGATAGAGGCCAGG 0: 5
1: 45
2: 300
3: 835
4: 1386
1027809757_1027809761 12 Left 1027809757 7:82880592-82880614 CCATGTCTAGAAACATTTTTGGT 0: 1
1: 4
2: 34
3: 101
4: 392
Right 1027809761 7:82880627-82880649 ACGATGCTACTGGCATTTAGTGG No data
1027809757_1027809762 19 Left 1027809757 7:82880592-82880614 CCATGTCTAGAAACATTTTTGGT 0: 1
1: 4
2: 34
3: 101
4: 392
Right 1027809762 7:82880634-82880656 TACTGGCATTTAGTGGATAGAGG 0: 3
1: 55
2: 338
3: 872
4: 1361
1027809757_1027809764 25 Left 1027809757 7:82880592-82880614 CCATGTCTAGAAACATTTTTGGT 0: 1
1: 4
2: 34
3: 101
4: 392
Right 1027809764 7:82880640-82880662 CATTTAGTGGATAGAGGCCAGGG 0: 6
1: 44
2: 369
3: 941
4: 1428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027809757 Original CRISPR ACCAAAAATGTTTCTAGACA TGG (reversed) Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903078328 1:20788805-20788827 ACCAAGATTGTTTTGAGACAGGG - Intergenic
903685949 1:25132147-25132169 ATCAAAAATGTTCCTAGGCCCGG + Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906970022 1:50503007-50503029 ATTAAAAATGTTTTTAGAGATGG + Intronic
908367252 1:63438136-63438158 AAAAAAACTGGTTCTAGACACGG + Exonic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911473929 1:98352982-98353004 AGTAAAATTGTTTCTAGAAATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913680225 1:121183469-121183491 ACTACAAATGTTGGTAGACATGG + Exonic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916198199 1:162244775-162244797 AACAAAAATTTTTTTAGATATGG + Intronic
918308715 1:183270177-183270199 ACCAAAAAAGTTTCAAGGCCAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
920467537 1:206202005-206202027 ACTACAAATGTTGGTAGACATGG + Exonic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922139217 1:222865396-222865418 AACTTAAATGTTTCTATACAGGG - Intergenic
922568384 1:226616990-226617012 ACCAAAGATGCTTCCAGAAATGG + Intergenic
923034794 1:230278293-230278315 AAAAAAAATGTTTGTAGAGATGG + Intronic
923547834 1:234936674-234936696 AGCAAAACTGTTTCAAGATATGG - Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924178294 1:241415529-241415551 AGCAATAATGTATCTAGACATGG + Intergenic
1063529452 10:6817301-6817323 CCCTAAAATGTTTCCATACATGG + Intergenic
1063992305 10:11579316-11579338 GCCATTAATGTTTTTAGACAGGG - Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065570673 10:27068479-27068501 ATGTAAAAGGTTTCTAGACAGGG + Intronic
1066090904 10:32018857-32018879 TACAAAAATTTTTTTAGACAGGG - Intronic
1066367278 10:34789308-34789330 ACCAAAATTTTTGCGAGACATGG + Intronic
1068125587 10:52838642-52838664 ACAAAAAATGTTTATAAGCATGG - Intergenic
1068474095 10:57503248-57503270 ACCAAAAATATTTCTGGATATGG + Intergenic
1071403022 10:85296862-85296884 GCCAACAATTTTTCTAGAAATGG + Intergenic
1072585031 10:96773970-96773992 TCTAGAAATGTTTCTAGAAAGGG + Intergenic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1072849796 10:98877045-98877067 ACAAAAAATGTTTTTGAACATGG - Intronic
1074117917 10:110471465-110471487 AAAAAAAATGTTTCTAGGCTGGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074684230 10:115944487-115944509 ACCTAAAATGTTTCTTGACTTGG - Intronic
1075170016 10:120104470-120104492 ACCAAAAATGTCTCTATCCCTGG - Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076269799 10:129141824-129141846 ACCAAAACTGTTTCAAAACAGGG + Intergenic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1077619454 11:3707450-3707472 ACCAAAAAAAATTCTAGACTGGG + Intronic
1078281252 11:9903422-9903444 ACCAAATATGTTACCAGTCAAGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079947011 11:26756454-26756476 AGCAGAGATGTTTCTAAACAAGG - Intergenic
1080090288 11:28340331-28340353 AGCAAAAATTTTTATAGAGAGGG - Intergenic
1080451466 11:32381902-32381924 ACCACCACTGTTTCTAGGCAAGG - Intergenic
1080750864 11:35148783-35148805 ATTAATAATGTTTCTAGACTTGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082694244 11:56340486-56340508 ACTAAAAATTTGTCTAGTCAGGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083284480 11:61649443-61649465 AAAAAAAATTTTTCGAGACAGGG + Intergenic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084198819 11:67541828-67541850 ATAAAAAATGTTTTTAGAGATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085135273 11:74081733-74081755 ACTTAAAATGTTTCAAGAAAGGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087200362 11:95338669-95338691 AACAAAAATGCTGCCAGACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089573788 11:119427094-119427116 ACCAATAATGTTCCAAGGCACGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090764789 11:129867102-129867124 ACCAAAAAGCTGACTAGACAGGG + Intronic
1092042913 12:5401125-5401147 ACCAAAAATGCTTCTCAAGAAGG + Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092515244 12:9204735-9204757 AACAAACATGTTTATAAACATGG - Intronic
1092812334 12:12283593-12283615 ACCTAAAATGTCTCTGGACTTGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1093766328 12:22967470-22967492 ACAAAAATAGTTTCTAGTCAGGG - Intergenic
1093772389 12:23032909-23032931 AACAAAAATGTTTATATATAAGG + Intergenic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094310994 12:29082845-29082867 CTCAAAAATGTTTTTAAACAAGG + Intergenic
1095877978 12:47102784-47102806 ACAATAACTGTTTCTAGGCACGG - Intronic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1096564607 12:52468182-52468204 GCCAAAAATGTTTCTCCACTGGG + Intergenic
1096942431 12:55361737-55361759 TCAAAAAATGTTTTTAGAGACGG + Intergenic
1099801823 12:87466624-87466646 ACTAAAAGAGTTTCTAGGCAAGG - Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100025227 12:90120300-90120322 ACGATAAATGTTTCTGGGCATGG + Intergenic
1100158280 12:91827675-91827697 ACCAAAAGAGCTTCTTGACAAGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101987622 12:109460173-109460195 AAACAAAATGCTTCTAGACATGG - Intronic
1102052825 12:109875457-109875479 ACCACAGAGGCTTCTAGACAGGG + Intronic
1103307852 12:119980373-119980395 ACCACAAATCTTTCTAGATGTGG + Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107550134 13:41466335-41466357 CCCCAAAATGATTCGAGACAGGG - Intronic
1107782625 13:43920811-43920833 ACGAAAAAAGTTCCTAGAAATGG - Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108894152 13:55302149-55302171 AATAAAAATATTTCTAGGCAAGG + Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1110027764 13:70563386-70563408 ACAAAAGATTTTTCTAGAAAAGG - Intergenic
1110174911 13:72544591-72544613 GCCAAAGAAGTTTCTAGTCAAGG - Intergenic
1110601677 13:77381937-77381959 CCCAGAAATGTTTCTATAGAGGG + Intergenic
1110777316 13:79423097-79423119 AGCAAAGGTGTTTCTAGTCAGGG - Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1111863650 13:93740919-93740941 AACAAGAATGTTTCTGGAAAGGG + Intronic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114200984 14:20519652-20519674 AACAAAAATATTTTTAGAGATGG + Intergenic
1114415013 14:22536951-22536973 CCCAAATATGTTTCTGGAAACGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115463431 14:33687022-33687044 CCCAAAAATGTTTCTTCTCAAGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116787045 14:49299313-49299335 ATTAAAAATCTTTGTAGACAAGG - Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1118756559 14:68849148-68849170 ACAAAAAAAGTTTGTAGAGATGG - Intergenic
1119047184 14:71329445-71329467 ATAAAAAATTTTTCGAGACAGGG + Intronic
1119142294 14:72278259-72278281 AACCAAATTGTTTCTGGACAAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1120395674 14:83964183-83964205 AACAAAAATGTTTGTGGAAATGG + Intergenic
1120416522 14:84225715-84225737 ACCAAGAATGTTTCTCAACAGGG - Intergenic
1120455087 14:84719640-84719662 ACCCAGAATGTGTCTAGGCATGG - Intergenic
1120516255 14:85474379-85474401 ACCAAGAATTTTTCTACACCTGG + Intergenic
1121132738 14:91463607-91463629 ACAAAAAATTTTTGTAGAGATGG + Intronic
1121206776 14:92175911-92175933 ACAAAAAATGTTTATAAACATGG - Intergenic
1202941040 14_KI270725v1_random:145805-145827 ATCAAAAATGCTTTTAGAGATGG - Intergenic
1124572155 15:30874131-30874153 AACAAAAATTTTTATAAACAGGG - Intergenic
1127684872 15:61333549-61333571 ACAAATATTGTATCTAGACATGG - Intergenic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129381733 15:75172119-75172141 AAAAAAAATGTTTGTAGAGAGGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1130997506 15:88912175-88912197 CCCAAAGATGTTTTTATACAGGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131597372 15:93812289-93812311 ACCAAAAATTTTTCTTGATATGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132815696 16:1825544-1825566 ACCGAACATGTTTCTGGACTTGG - Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133579989 16:7135222-7135244 AACAAAAAAATTCCTAGACAGGG - Intronic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133807553 16:9137172-9137194 ACTAAATATGTTTCTATCCATGG - Intergenic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134242314 16:12515045-12515067 TCCAAAAATGTTGCTAGTGACGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134614570 16:15641088-15641110 AACAAAAATTTTTTTAGAGATGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135273758 16:21092423-21092445 ACAAAAAAAGAATCTAGACACGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135866860 16:26111249-26111271 AAAAAAAATGTTTGTAGAGATGG + Intronic
1136084827 16:27877407-27877429 TACAAAAATGAATCTAGACAGGG - Intronic
1136236736 16:28918823-28918845 ACAAAAAAAGTTTTTAGAGATGG + Intronic
1137291316 16:47053877-47053899 ACCAAAAACGTGTCTAAAGACGG - Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1139553870 16:67693564-67693586 CCCAAAAAAGATTCTAGCCAGGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140755965 16:78066880-78066902 GTTAAAAATGTTTCTAGGCACGG + Intergenic
1140837745 16:78810954-78810976 ACCAAATATGCTTCTGGCCACGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141449178 16:84085863-84085885 CCCAAACATGTTTCTTTACAAGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146299017 17:31673746-31673768 AACAAAATTTTTTCGAGACAGGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148519438 17:48256795-48256817 ATAAAAAATATTTCTAGAAATGG + Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150589942 17:66553363-66553385 ACCAAAGATCTTTCTAGCTATGG - Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1152075332 17:78155992-78156014 AACAAAAATGTTTCTGGAATAGG - Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152764761 17:82130188-82130210 AAAAAAAATGTTTTGAGACAGGG - Intronic
1153885934 18:9466119-9466141 ACAAAATATGCTTCAAGACAAGG - Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154214261 18:12404169-12404191 AAAAAAAATGTTTTTAGAGACGG - Intergenic
1155751583 18:29429423-29429445 ACAAAGAATGTTACTAAACAAGG + Intergenic
1156357617 18:36355857-36355879 ACCACAAATGTTCCTAGGAAAGG - Intronic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1156986143 18:43353451-43353473 AAGAAAAATGTTTCTTGCCAAGG - Intergenic
1157110236 18:44813828-44813850 ACCACATCTGTTTCTGGACATGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158445295 18:57515256-57515278 ACAAAAAATTTTTTGAGACAAGG + Intergenic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161462427 19:4406278-4406300 ACCAAAAATATCTCTATACGTGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162136265 19:8557301-8557323 ACAAAAAAAGTTTTGAGACAGGG + Intronic
1162399928 19:10439475-10439497 ATCAAAAATGTTTGTAGGCCAGG - Intronic
1163240353 19:16059018-16059040 GTCAAAACTGTTTCTGGACACGG - Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164285573 19:23813056-23813078 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164317871 19:24110388-24110410 AAAAAAAATGTTTGTAGAGAGGG - Intronic
1164449420 19:28347613-28347635 ATCAAAAATTTTTCCAGAAAGGG + Intergenic
1164461975 19:28456629-28456651 ACAAAAAATTTTTGTAGAGATGG - Intergenic
1164576440 19:29408041-29408063 ACCAAAGAGGGGTCTAGACAGGG - Intergenic
1164675909 19:30101310-30101332 CCCAAATATGTTTCTAGGCCAGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165573265 19:36793104-36793126 AAAAAAATTGTTTTTAGACAGGG + Intergenic
1166168049 19:41006311-41006333 AAAAAAAATGTAGCTAGACATGG - Intronic
1167451675 19:49574013-49574035 ACAAAAAAAGTATCTAGGCATGG - Intronic
1167473430 19:49687537-49687559 ACCACAAATGTTTCCACAGACGG - Intronic
1167925084 19:52814729-52814751 ACCAAAAAATTATCTGGACATGG + Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168371973 19:55843301-55843323 CCCTATAATGTGTCTAGACATGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925435943 2:3837665-3837687 AGCAAAATTGTTGCTAGACTAGG - Intronic
925701519 2:6643649-6643671 GCCAAAACTGAATCTAGACACGG + Intergenic
926215911 2:10905257-10905279 CCCAAAAATCTCTCTAGCCACGG + Intergenic
926713516 2:15903625-15903647 TTCAAAAATTTTTCGAGACAGGG - Intergenic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930702530 2:54473157-54473179 AGAAATAATGTTTCTATACAAGG - Intronic
933516130 2:83304868-83304890 AACAAAAATGTGCCTAGAGATGG - Intergenic
935024059 2:99259485-99259507 AACAAATATATTCCTAGACATGG - Intronic
935574261 2:104692581-104692603 ACCAAAATTGTTTCTAGGACAGG + Intergenic
935817718 2:106862802-106862824 AGAAAAAACATTTCTAGACAGGG + Intronic
935891397 2:107682693-107682715 CACAATAATGTATCTAGACATGG - Intergenic
936158060 2:110062811-110062833 ACCAGAATTGTTTATAAACAAGG - Intergenic
936186631 2:110308636-110308658 ACCAGAATTGTTTATAAACAAGG + Intergenic
936600865 2:113893028-113893050 ACCAAAAAAGTGTGTAGATAAGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938132944 2:128732846-128732868 AACAAAAAGGTTTGTAGTCAAGG + Intergenic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
939413132 2:141857505-141857527 AAAAAAAATTTTTGTAGACATGG + Intronic
939786218 2:146516563-146516585 GCTAACCATGTTTCTAGACATGG - Intergenic
939854810 2:147345363-147345385 ACAAGAAATGTTTCTGGACTTGG + Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941264704 2:163347180-163347202 ACCAAAAATGCATCTACATAAGG + Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
943282541 2:185955195-185955217 AGCAAAATTGTTGCTAGACTAGG + Intergenic
944109478 2:196116664-196116686 ACCAAAAATGTAGCTGGACGTGG - Intergenic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
946736346 2:222758085-222758107 AAAAAAAATTTTTTTAGACATGG - Intergenic
946972753 2:225113422-225113444 AACAAAAATGTTCCTGTACATGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947287481 2:228532621-228532643 ACCAAAAAAATATCTAGAGAAGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1168940821 20:1709761-1709783 AACAGAAATGTTTTTGGACAGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173705209 20:45105162-45105184 ACAAGAAATGTTTCTATAGATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175917555 20:62433739-62433761 GCCACAACTGTTTCTAGCCAGGG - Intergenic
1177151287 21:17457810-17457832 ACAAAAACTATTTATAGACATGG + Intergenic
1177289645 21:19094642-19094664 AGCAAAAGTGTTTCTTGATAAGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181851414 22:25752661-25752683 AAAAAAAATTTTTTTAGACATGG + Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182364802 22:29771354-29771376 GCCAAAAATTTTTAGAGACAGGG - Intergenic
1182729775 22:32478740-32478762 AACAAAAATGTAGCTGGACATGG + Intronic
1182834158 22:33327887-33327909 ACCACAAATGCTTCAAGAAAAGG + Intronic
1183156402 22:36078893-36078915 TCAAAAAAAGTTTCTAGACAAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184006267 22:41711771-41711793 ACCACAAATGATTGTAGAGAAGG + Intronic
949618248 3:5780530-5780552 ACCATAAAAGTTTCTGCACAAGG - Intergenic
949969274 3:9389495-9389517 GCCAAAAATTTTTTTAGAGATGG - Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
952186888 3:30979364-30979386 AGCAAAAATGTTTGTAGACCAGG - Intergenic
953011710 3:39032004-39032026 ACCAAAAATGGTTATACAAAAGG + Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
954767707 3:52935056-52935078 ACCAAAAATGCTTCTCTAGATGG + Intronic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957336718 3:78839370-78839392 CCCAAAAAAGTTTCTGGACTAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957484935 3:80848293-80848315 ACCTAAAATGTTTGTAGATGGGG - Intergenic
959196776 3:103193239-103193261 ATAAAAAGAGTTTCTAGACAAGG + Intergenic
959234403 3:103700330-103700352 ACCAAATATGCTTCTACAAATGG + Intergenic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
959765250 3:110019014-110019036 ACCACAGATGTATCTAGAAATGG - Intergenic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960734945 3:120768815-120768837 ACCTAAAACCTTTCTAGCCAAGG + Intronic
960839411 3:121941044-121941066 AAAAAAAATGCTTCAAGACAGGG - Exonic
960890147 3:122439358-122439380 AAAAAAAATGTTTTTAGAGATGG + Intronic
961360276 3:126362845-126362867 ATTAAAGATGTTTTTAGACATGG - Intergenic
961373190 3:126444860-126444882 TCCACTAATGTTGCTAGACATGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962188703 3:133287744-133287766 ACCAAAAAAGTTTTTAGTTAGGG + Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963168406 3:142227479-142227501 ATCAAAACTTTTTTTAGACAGGG + Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
964097852 3:152953953-152953975 ACAAGAAATTTTTCTAGACTAGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964466037 3:156994331-156994353 ACCAAATCTGTTTCTACACCAGG + Intronic
964769955 3:160213860-160213882 AACAAAAACTTATCTAGACATGG - Intergenic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
968277319 3:197450323-197450345 AGCAGAAATGTTGATAGACAAGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969392321 4:6900196-6900218 ACCAAAAATGTAGCTGGGCATGG + Intergenic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
973875421 4:55213432-55213454 ACCACAAATGTTTCAAGCAAAGG + Intergenic
975330684 4:73109001-73109023 ACCAAAAATTTATCTAGGCTGGG + Intronic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976114340 4:81710946-81710968 ACCCTAAATGTTTGTAGACTTGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977627967 4:99209089-99209111 TTCAAAAATATTTCTAGATATGG + Intronic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979128973 4:117015467-117015489 ACAAAAAATGTTTCTAAAGGGGG + Intergenic
979763948 4:124442324-124442346 ACAAAAAAGGTTTTTAGAAAAGG - Intergenic
980210310 4:129778983-129779005 ACAAAAATTGTTTGTAGAAATGG + Intergenic
980677596 4:136109331-136109353 AACAATAATTTTTCTAAACATGG - Intergenic
981451870 4:144907567-144907589 ACCCAAAAGGGTTCTAGGCAGGG - Intergenic
981742017 4:148012566-148012588 AACCGAAATGTTTCTAAACAAGG - Intronic
982014307 4:151138176-151138198 ATGAAAAAAGTTTATAGACATGG + Intronic
982659742 4:158192524-158192546 ACAAAAAATATTTCTAAACCTGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983754427 4:171317169-171317191 AAAAAAAATGTTTTTAAACAAGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987065261 5:14283991-14284013 ACCAAAAATCATTCTAAAGAAGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987296184 5:16554008-16554030 CCCAAAAATGTTTCAAGATTTGG - Intronic
988447584 5:31305093-31305115 ACCAAAAATGTTTCGTGTCTTGG + Intronic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990364310 5:55054254-55054276 GACAGAAATGTTTCTAGCCAGGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991450086 5:66742440-66742462 AATAAAATTGTTTATAGACATGG + Intronic
991581366 5:68158563-68158585 AAAAAAAATGTTTTTAGAGAAGG - Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
991699201 5:69301455-69301477 AAAAAAAATTTTTGTAGACATGG - Intronic
991997877 5:72405958-72405980 ATCATAAATCTTTCTGGACATGG + Intergenic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993144966 5:84082208-84082230 ACCAATAATATTTCCACACATGG - Intronic
993509202 5:88750376-88750398 AAAAAAAATGTTTGTAGAGATGG + Intronic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994040402 5:95252813-95252835 ACAAAAAAAGTATCTAGATAGGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
996686488 5:126287215-126287237 ACCAAGGATGTTTCTAGATACGG + Intergenic
997054908 5:130430546-130430568 AAAAAAAATGAATCTAGACACGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998196633 5:140078970-140078992 AGCAAAAATTTTTCTATAAAGGG - Intergenic
998228256 5:140343256-140343278 ACAAAAATTGCTTCTAGAGAAGG + Intronic
998611569 5:143694844-143694866 AACAAAAATGTTTCTTAAAAGGG - Intergenic
999553170 5:152712382-152712404 ACCAATAATGATTCCAGAGATGG - Intergenic
999817009 5:155187124-155187146 ACTAAAAATGTTTCTAAAAGTGG - Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002673316 5:180888068-180888090 ACAAAAAAATTTTCTAGGCATGG + Intergenic
1002809069 6:608381-608403 TTAAAAAATGTTTCTAGAAAAGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004796566 6:19092908-19092930 ACCCAAAACTTTTATAGACAGGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006537719 6:34713464-34713486 ACAAAAAATGTAGCTAGGCATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007130571 6:39469538-39469560 AAAAAAAATGTTACTAGAGATGG + Intronic
1007202495 6:40121667-40121689 ACCAAAACTGATTTGAGACAGGG - Intergenic
1007493172 6:42240103-42240125 AACAAAGATGTTTCCACACAAGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007753895 6:44086389-44086411 AAAAAAAATGTTTTTAGAGATGG - Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009274443 6:61657200-61657222 ACTGAAAATGTTTTTACACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1009733915 6:67649807-67649829 AACTAAAATTTTTCTAGAAATGG + Intergenic
1009742422 6:67763750-67763772 AGGGAAAATGTTTCTTGACATGG + Intergenic
1009761155 6:68008350-68008372 AGCAAAAATGTTTTGAGTCATGG - Intergenic
1012033765 6:94105639-94105661 ACCTAAGATGTGTCTAGACTTGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015102044 6:129492856-129492878 ACTAAAACTGTTTCTAGGCCAGG + Intronic
1015521027 6:134131365-134131387 ACCAAAAATGTTTCAACCTAAGG + Intergenic
1016382269 6:143497131-143497153 AAAAAAAATTTTTGTAGACAGGG + Intronic
1017556851 6:155581209-155581231 AACAAATATGTTTAAAGACATGG + Intergenic
1017578915 6:155838781-155838803 ACAAAAAATGTTAGAAGACAGGG - Intergenic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1019704310 7:2490226-2490248 TCCAAAAATGTTTTTGGAAACGG + Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020401168 7:7779439-7779461 ACAAAAAAAGTTTCTACAGATGG + Intronic
1020612120 7:10411475-10411497 ACCAAAAATATCACTAGACGGGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021769154 7:23981167-23981189 ACAAAAATTGTTTCTGGAGATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1021983127 7:26073989-26074011 TTAAAAATTGTTTCTAGACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022778025 7:33547767-33547789 AACAATAATGTTTCAAAACAAGG - Intronic
1022898281 7:34774849-34774871 ACCAAAAATATTCCTAGATGTGG + Intronic
1023799292 7:43819617-43819639 ATCAAAAATGTTGCTTTACAAGG - Intergenic
1024757202 7:52548768-52548790 AACAAAAATGTTACTAAACAAGG - Intergenic
1025292806 7:57746064-57746086 ACCAAACATATATCTTGACAGGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027981897 7:85235152-85235174 ACAGAAAATTTTTCTAGAAAGGG - Intergenic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030417115 7:109259120-109259142 ACCAAATATGTTTCAATAAAAGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031327330 7:120418007-120418029 ACAAAAAATGTTTCTTGAATCGG - Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032559368 7:132872797-132872819 ACCAAAAATCTTTTTAAAGAGGG + Intronic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1035415076 7:158676601-158676623 CCCAAATATGTTTCAAGACAGGG + Intronic
1035482846 7:159201360-159201382 ACAAAAAATGTTTGTAGGCCGGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037280880 8:17240571-17240593 AACAAAGGTGTTTCTAGAAAAGG + Intronic
1037873539 8:22523595-22523617 TCCAAAAATGTTTTTGAACAAGG - Intronic
1038131314 8:24734620-24734642 ACCAATAAAATTTCAAGACAAGG + Intergenic
1038793597 8:30690892-30690914 AAAAAAAATTTTTGTAGACATGG - Intronic
1039121665 8:34154805-34154827 GACAAAAATGGTTTTAGACAGGG + Intergenic
1039226875 8:35397949-35397971 AAAAAGAATGGTTCTAGACAGGG - Intronic
1041679149 8:60569384-60569406 ATCAAGAATGTTTCTAAACCAGG - Intronic
1042261784 8:66867148-66867170 AAAAAAAATTTTTTTAGACACGG - Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1044796427 8:95903684-95903706 ACCAGAGATGTTTCTAGGAATGG + Intergenic
1045068208 8:98471717-98471739 ATTCAAAATCTTTCTAGACAAGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046051833 8:109032783-109032805 AACAAAAATTTTTCTACAAAGGG + Intergenic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1048807424 8:138253649-138253671 ACCAAACATGTCTCTGGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051514816 9:17917648-17917670 ACCAAAGATATTTCAAGAAAAGG - Intergenic
1051865191 9:21672585-21672607 ACTAAAAATGTTTGTAGGCAAGG + Intergenic
1052130665 9:24842655-24842677 AAGAAAAATGAATCTAGACACGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052808851 9:33038296-33038318 ACCAAAGATGTTTTTAGGCCAGG - Intronic
1054680920 9:67916806-67916828 AAAAAAAAAGTTTGTAGACATGG + Intergenic
1054937625 9:70705459-70705481 AACAAAATTATTTGTAGACATGG + Intronic
1054939316 9:70723452-70723474 AACAAAATTATTTGTAGACATGG + Intronic
1055506267 9:76952630-76952652 ACCAAAAATGTTTCTAGAGTGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058699092 9:107586433-107586455 ACTAAAAATTTTTATAGAGATGG + Intergenic
1058838606 9:108882763-108882785 TAAAAAAATGTTTTTAGACAGGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060276936 9:122189589-122189611 AAAAAAAATTTTTATAGACAGGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061223434 9:129266032-129266054 ACAAAAAATTTTTTGAGACAGGG + Intergenic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185516830 X:706280-706302 AAAAAAAATTTTTGTAGACATGG + Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186524914 X:10239459-10239481 ACCACAAAAGTTTCCAGGCATGG - Intergenic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186631932 X:11358935-11358957 CATTAAAATGTTTCTAGACATGG - Intronic
1186682969 X:11895280-11895302 AACAAAGATGTTTCCAGGCATGG + Intergenic
1187404055 X:18986307-18986329 ACTGAAAATGTTTCTATACTAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187911911 X:24119122-24119144 ACAAAAAATGTGTCTAGGCTGGG - Intergenic
1188281120 X:28270863-28270885 ATCAAAAATGTTCCTAGATTAGG - Intergenic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189448302 X:41102320-41102342 ATAAAAAATGTTACTAGACTGGG + Intronic
1190363548 X:49671093-49671115 ACCAAAAATGTCTCTACGCTGGG + Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1191589331 X:62863724-62863746 ACCAAAAATATTTAAAGAGAGGG - Intergenic
1193221427 X:78931019-78931041 ATTTAAAATGTTTCTAGGCAGGG + Intergenic
1193473223 X:81932453-81932475 TCCAAGAATGTTTCTAGATCAGG - Intergenic
1193648836 X:84104559-84104581 AACAAAAATGTTTCTCGGAACGG - Exonic
1194889596 X:99362235-99362257 TACAAAAATGTTTCTGGAGAAGG + Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1197880282 X:131159124-131159146 ACCAAAAATGATCCTAGAAGCGG + Intergenic
1198204419 X:134452521-134452543 GGCAAAAATGTTTTGAGACAGGG - Intergenic
1198510970 X:137351211-137351233 TCCAAAAATTTTTCTAGTTATGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201236469 Y:11916706-11916728 ACTAAACATGTGTCTACACATGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic