ID: 1027812523

View in Genome Browser
Species Human (GRCh38)
Location 7:82922830-82922852
Sequence ATGTCTCTCTAGCAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027812523 Original CRISPR ATGTCTCTCTAGCAGTATGA TGG (reversed) Intronic
905194269 1:36262590-36262612 ATGTCTGTATATCAGTATGGGGG + Intronic
908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909605071 1:77499738-77499760 GGGTCTCTCTAGGAGTCTGATGG - Intronic
917009012 1:170449931-170449953 ATGTAGGTCTAGCAGTCTGAGGG - Intergenic
924294127 1:242568323-242568345 ATTTCTCTCTTGGGGTATGATGG - Intergenic
1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG + Intergenic
1063864874 10:10353112-10353134 ATATCCCTCTTGCAGTATGTGGG + Intergenic
1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG + Intronic
1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG + Intronic
1073085905 10:100888616-100888638 ATGTCTGTCTGGCAGGATGGTGG + Intergenic
1074431137 10:113395798-113395820 GTGTCTCTCTAGGACTATGAGGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1079909686 11:26294252-26294274 ATGGCTCTCTAACAGTCTTACGG - Intergenic
1087666994 11:101061606-101061628 ATTTGTCTATAGCAGTATAAGGG + Intronic
1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG + Intronic
1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG + Intronic
1099609298 12:84846842-84846864 ATTTTTCTCTAGAAATATGAAGG - Intergenic
1099982785 12:89625823-89625845 ACTGCTCTCTAGGAGTATGATGG - Intronic
1100543278 12:95578176-95578198 AAGTCACTCTAGCTGTTTGATGG - Intergenic
1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG + Intergenic
1102069136 12:110003107-110003129 ATGTCTCACCATCAGTAAGAAGG - Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1107562415 13:41569925-41569947 TTGTCTCTCCAGCAATAAGAAGG + Intronic
1112045611 13:95594346-95594368 ATGTATCTATAGAAGCATGATGG + Intronic
1112555641 13:100466189-100466211 ATGTCTCACCAGCAGGATTACGG - Intronic
1113012467 13:105785581-105785603 ATCTTTCTCTAGCAGTAACAAGG - Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1114020971 14:18478353-18478375 ATGTGTCTCTAACATTCTGAGGG + Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1115832827 14:37361636-37361658 TTGCCTCTCTCGCAGTCTGAAGG + Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG + Intergenic
1124213335 15:27782676-27782698 ATGTCGCATTAGCACTATGAGGG - Intronic
1127822680 15:62673812-62673834 ATGTCTCTCTCTTAGTCTGAAGG + Exonic
1130611756 15:85367550-85367572 ATGTTTCCCTAGCAGTATCCTGG - Intergenic
1142930956 17:3283848-3283870 TTGTATCTCTAGCTGTCTGAGGG - Intergenic
1142944459 17:3412661-3412683 TTGTATCTCTAGCTGTCTGAGGG + Intergenic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1149645199 17:58235845-58235867 ATGTCTCTCTAGCAGACAGGAGG - Intronic
1152944466 17:83191491-83191513 ATGTCTCTCTCCCAGAATTAAGG - Intergenic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG + Intronic
1154942034 18:21123564-21123586 ATTTATCTCTAGAACTATGAGGG - Intergenic
1155241049 18:23863901-23863923 ATGTCCCACAAGCAGCATGATGG - Intronic
1156951730 18:42908689-42908711 ATGTCTTTATTTCAGTATGAAGG - Intronic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG + Intergenic
934790862 2:97058947-97058969 TTGACTCTTTAGCAGTATGTGGG - Intergenic
934815590 2:97323583-97323605 TTGACTCTTTAGCAGTATGTGGG + Intergenic
934822105 2:97384900-97384922 TTGACTCTTTAGCAGTATGTGGG - Intergenic
940780497 2:157928304-157928326 ATGACTCTGAATCAGTATGATGG - Intronic
946150647 2:217765737-217765759 ATGTCTCTGTAACACTATGTAGG - Intergenic
948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG + Intronic
1169702043 20:8457511-8457533 GTGTTACTCTAGCAGTGTGATGG - Intronic
1171325062 20:24283931-24283953 ATGTCTTTATAGCAGTGTGAGGG - Intergenic
1178307800 21:31504914-31504936 ATTTCTGTCTTGCAGTATCAGGG - Intronic
1180445451 22:15408891-15408913 ATGTGTCTCTAACATTCTGAGGG + Intergenic
1181318838 22:21989269-21989291 ATGTCTTTCCAGCAGTGTCAGGG - Intergenic
951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG + Intronic
956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG + Intronic
960559802 3:119071692-119071714 ATGTATCTCTGGCATGATGATGG - Intronic
964529609 3:157652935-157652957 ATGTCTCTCTATGAGTGTGTGGG - Intronic
971005003 4:22363522-22363544 ATGTCTCTCTACTAGTATAATGG + Intronic
979160173 4:117449442-117449464 ATGTCTCTCTGGTTGTATCAGGG - Intergenic
979906900 4:126305551-126305573 ATGTCACTCTAGTAACATGACGG + Intergenic
980903479 4:138927280-138927302 ATGTCTCTTTAGCAGTTTCCTGG - Intergenic
988836867 5:35041679-35041701 ATGTCTCTTTCTCAGCATGAAGG + Intronic
990633165 5:57693106-57693128 ATGTCTGTCTAGAAGGATTAAGG - Intergenic
992924135 5:81563781-81563803 ATGTTTCTCTAGTAGTTTTATGG - Intronic
1001349738 5:170948842-170948864 ATGTCTGTCTACCTGTATGCTGG - Intronic
1005941346 6:30562551-30562573 ATTTCTCTGTAGCCCTATGATGG + Exonic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG + Intergenic
1010380279 6:75216014-75216036 ACGTCTCCCTAGCAGTTAGATGG - Intergenic
1012932281 6:105329726-105329748 TTGTCTCTCTAGCACTTTGCAGG - Intronic
1020388744 7:7635724-7635746 ATCTCTCTCTAGCACCATGTTGG - Intergenic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027858619 7:83545832-83545854 ATATATCTCCAGTAGTATGACGG + Intronic
1028979334 7:96949871-96949893 ATGTCTCTCTTTCAGTATGCAGG - Intergenic
1030462615 7:109859556-109859578 ATGTCTCTGTAGAAATATCAGGG + Intergenic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1032675533 7:134126982-134127004 ATGTCTCTAAAGCAGTCTGTAGG - Intergenic
1032918233 7:136515462-136515484 AACTCTCTCTAGCAATAGGATGG - Intergenic
1033410350 7:141111984-141112006 ATTTGTCTCTAGAAGTATTAAGG + Intronic
1035891299 8:3346498-3346520 ATCTCACACTGGCAGTATGAGGG - Intronic
1036414518 8:8534852-8534874 CTATCTCTCTAACAATATGAAGG - Intergenic
1043607480 8:82019755-82019777 ATGTCTTTATAGCAGTGTGAAGG + Intergenic
1044130413 8:88516701-88516723 ATGTATTTCTAGCAGAATGTTGG + Intergenic
1044433201 8:92133102-92133124 ATGTCTTTCTAGCTGTGTTAAGG - Intergenic
1045625605 8:104044767-104044789 ATGTCTCCCTTACAGTATTAGGG - Intronic
1046953187 8:120037646-120037668 ATGTCACTCTAGCAGAAGAATGG + Intronic
1047704128 8:127480660-127480682 ATGTCTCTTTAACAGTATTAAGG - Intergenic
1050518271 9:6468905-6468927 TTATCTCTCCAGCAGTAGGAAGG + Intronic
1055455599 9:76468669-76468691 ATCTCTCTTTAGCAGAAAGATGG + Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1194067439 X:89278785-89278807 TTATCTCTCTAGCAATATTAGGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1197169053 X:123410840-123410862 GTGTCTCTGTAGCTGGATGAAGG - Intronic
1198039732 X:132838246-132838268 ATGACTCTCTGGCAGTAAAAGGG - Intronic
1200721598 Y:6612994-6613016 TTATCTCTCTAGCAATATTAGGG - Intergenic