ID: 1027813045

View in Genome Browser
Species Human (GRCh38)
Location 7:82930298-82930320
Sequence AGGGAGAAACAGCATTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027813036_1027813045 19 Left 1027813036 7:82930256-82930278 CCTACAATGTCTACTGCACAGTG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG No data
1027813035_1027813045 25 Left 1027813035 7:82930250-82930272 CCAGGACCTACAATGTCTACTGC 0: 1
1: 0
2: 0
3: 10
4: 80
Right 1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG No data
1027813034_1027813045 26 Left 1027813034 7:82930249-82930271 CCCAGGACCTACAATGTCTACTG 0: 1
1: 0
2: 1
3: 4
4: 105
Right 1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027813045 Original CRISPR AGGGAGAAACAGCATTAGGA GGG Intronic
No off target data available for this crispr