ID: 1027816839

View in Genome Browser
Species Human (GRCh38)
Location 7:82984778-82984800
Sequence AAGTAGCAAGAAGCAGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027816839_1027816841 -7 Left 1027816839 7:82984778-82984800 CCTATGCCTGCTTCTTGCTACTT 0: 1
1: 0
2: 1
3: 13
4: 313
Right 1027816841 7:82984794-82984816 GCTACTTCTGAAGTTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027816839 Original CRISPR AAGTAGCAAGAAGCAGGCAT AGG (reversed) Intronic
901593778 1:10368607-10368629 AAGCAGCAAAAACCAGGAATAGG - Intronic
903947109 1:26971009-26971031 AAGAAGCATGAAGCAAGCAGAGG - Intergenic
904269309 1:29338985-29339007 GTGTAGAAAGAAGTAGGCATAGG - Intergenic
904611559 1:31728639-31728661 AAGGAGCAACAAGGAGGCAATGG + Intronic
905691279 1:39944907-39944929 CAGTAGTAAGAAGCAGGGAAAGG + Intergenic
906791395 1:48661307-48661329 AGGTGGCAAGGAGCAGGCACAGG + Intronic
910549602 1:88461117-88461139 AAGGAGCAGGAAGCAGGCAGAGG + Intergenic
915677256 1:157543268-157543290 AAGGAGCAAGAAGCAGGTGCAGG - Intronic
915983273 1:160436951-160436973 AAATAGCAAGTACCAGGTATGGG - Intergenic
916554623 1:165883552-165883574 CAGTACCAAAAAGCAGCCATGGG - Intronic
917843126 1:178999003-178999025 AAGTAGAAAGAAGAAGGTAAAGG + Intergenic
918791480 1:188836199-188836221 AGATAGGAAGAAGAAGGCATAGG + Intergenic
919288607 1:195599472-195599494 AAGTAGTAAGAATCATGAATTGG + Intergenic
920234930 1:204496511-204496533 AACTAACAGGAAGTAGGCATAGG + Intergenic
920329701 1:205197430-205197452 AATTTGCATGAAGCAGGTATTGG + Intronic
920827972 1:209439757-209439779 AAGTGAGAAGAAGCAGACATAGG + Intergenic
921029437 1:211324954-211324976 GAGAGGCAAGAAGCAGGCAATGG + Intergenic
921425157 1:214992926-214992948 AAGAAACAAGAGGGAGGCATAGG - Intergenic
922436990 1:225615938-225615960 GTGTAGAAAGAAGCAGACATAGG + Intronic
923966165 1:239141332-239141354 AGGTAGAAAGATGCAGGCATGGG - Intergenic
924436912 1:244049561-244049583 AAGTCGTAAGAAGCAGCCAGCGG - Intronic
1063655431 10:7983321-7983343 AAGGGGCAAGAGGCAGGCAAAGG + Intronic
1063946519 10:11181469-11181491 AAATGGCAAGACTCAGGCATGGG - Intronic
1064229022 10:13513563-13513585 AAGTTACAAGAAGCAGGACTTGG - Intronic
1064322763 10:14320893-14320915 GAGCTGCAAGAAGCAGGCAAGGG - Intronic
1064767436 10:18688933-18688955 AAGGAGGAAGAAGAAGGCAGTGG - Intergenic
1064813779 10:19232816-19232838 AAAGAGCAAGAAGCAGGGTTGGG - Intronic
1067038293 10:42934615-42934637 CAGGAGCAAGGAGCAGGCTTTGG - Intergenic
1068603760 10:58982620-58982642 TGGTAGCAGGAATCAGGCATAGG + Intergenic
1069063868 10:63922411-63922433 AAGTAGCAGAAAGTAGGTATCGG + Intergenic
1069846002 10:71372063-71372085 AAGTAGTGAGAACCAGTCATCGG + Intergenic
1070098019 10:73357464-73357486 AAGTAGCAAGTAGCTTGCAGTGG + Intronic
1070161310 10:73868264-73868286 AAGCAGCAGGAAGAAGGCAGGGG + Intronic
1072396467 10:95048082-95048104 AAGTAAAAAGAAGCTGGCAGAGG - Intronic
1072480788 10:95809108-95809130 GTGTAGAAAGAAGTAGGCATAGG - Intronic
1073673446 10:105618226-105618248 CAATAGCAAGAAGCAGCAATGGG + Intergenic
1075215576 10:120529969-120529991 AAGTTGAAAGAAAGAGGCATTGG - Intronic
1077507761 11:2940059-2940081 AACTATGGAGAAGCAGGCATAGG + Intergenic
1078015785 11:7613323-7613345 AAGCAGCAAGATGCTGGCTTGGG - Intronic
1078614318 11:12850899-12850921 AAGAAGCAATGAGCATGCATTGG + Intronic
1078876750 11:15406826-15406848 AAGTGGCAACAAGCAGCCAATGG - Intergenic
1080914827 11:36646318-36646340 AAGCAGCAAGAGACAGGCTTGGG - Intronic
1082990725 11:59205289-59205311 AAGTAGCAAGAAGCCGGCTGAGG - Exonic
1084352559 11:68613041-68613063 AAGGAGCAACAGACAGGCATCGG - Intronic
1084615621 11:70233979-70234001 CAGGAGAGAGAAGCAGGCATTGG - Intergenic
1085521722 11:77142996-77143018 AAGTAGCCTGAGGCAGGCAGGGG - Intronic
1087571510 11:99932712-99932734 ATTTACCAAGAAGCAGGCACTGG - Intronic
1088110423 11:106254729-106254751 ATGCAGCAATATGCAGGCATGGG + Intergenic
1088133234 11:106521382-106521404 AGGTAGAAAGAATCAGGCAAAGG + Intergenic
1088760096 11:112921285-112921307 AATTAGAGAGAAGGAGGCATTGG + Intergenic
1089394440 11:118126716-118126738 AAGTACCAAGAAGCTGGGTTCGG + Intergenic
1089727818 11:120498111-120498133 AAGTAGAATAAAGCAGGCAAAGG + Intergenic
1090354852 11:126133450-126133472 AAGGAGGAAGTAGCAGGAATTGG - Intergenic
1090407397 11:126485219-126485241 AAGGAGCAAGACGCAGGTTTAGG + Intronic
1090592312 11:128285378-128285400 AAACAGAAAGAAGCAGGCCTTGG + Intergenic
1091044622 11:132314680-132314702 AAATAGCATGATGCTGGCATTGG - Exonic
1091195432 11:133726889-133726911 CAGCAGAAAGAAGCAGGCTTTGG - Intergenic
1091344547 11:134844075-134844097 AAGTAGCAAGGAGCGGGGAGAGG - Intergenic
1091595585 12:1876702-1876724 AAGAAGCATGATCCAGGCATGGG - Intronic
1092142295 12:6192168-6192190 ATGTAGAAAGAAGTAGACATAGG - Intergenic
1092160185 12:6311497-6311519 AACTAGCAAGAAGCAGTCACAGG + Intronic
1092226559 12:6752149-6752171 ACCTAGCAGGAAGTAGGCATCGG - Intronic
1093269137 12:17037161-17037183 AAGGGGAAAGAAGCAGGCATAGG - Intergenic
1093425851 12:19028015-19028037 AAGAAGCAATAAGCTGGCTTAGG + Intergenic
1093447513 12:19277133-19277155 AAGAAGCAGGAAGCAGGTCTGGG + Intronic
1095774961 12:46000724-46000746 GTGTAGAAAGAAGCAGACATAGG + Intergenic
1095821890 12:46487292-46487314 AATTAGAAAGAAGAAAGCATAGG - Intergenic
1096322319 12:50625950-50625972 AAATAGCAAGAAACAGAAATAGG - Intronic
1097817672 12:64092795-64092817 AAGCTGCAAGAAGCAGACGTAGG + Intronic
1098932503 12:76436164-76436186 AAGTAAAAAGATGCAAGCATTGG - Intronic
1099056077 12:77842534-77842556 ATCCAGCAAGAAGGAGGCATTGG + Intronic
1101085534 12:101231811-101231833 AAGTGGTGACAAGCAGGCATTGG + Intergenic
1101408753 12:104452423-104452445 GAGCAGCAAGAGGCAGGCAGGGG + Intergenic
1102128941 12:110509663-110509685 AAGTAGCAAGAATAGAGCATTGG + Intronic
1103185951 12:118957567-118957589 ACGTAGTAAGAGACAGGCATGGG + Intergenic
1103350039 12:120277882-120277904 GTGTAGAAAGAAGCAGACATAGG - Intergenic
1104266552 12:127238666-127238688 AAGGAGGAAAAAGAAGGCATAGG + Intergenic
1104597582 12:130130584-130130606 AATTAGGAAGAAGCAGGAAGAGG + Intergenic
1104899279 12:132179652-132179674 AAAGAGCAAGCTGCAGGCATGGG - Intergenic
1108467713 13:50733904-50733926 AAGTAGCAAGTAGCAAGTCTGGG + Intronic
1108538714 13:51414938-51414960 AATTAGAAAGAAGTAGGGATTGG - Intronic
1110768636 13:79309055-79309077 ATGTAGCATGACCCAGGCATTGG + Intergenic
1111580409 13:90215091-90215113 AACTAGAAAAAAGCAGGAATGGG + Intergenic
1115622226 14:35152317-35152339 GTGTAGAAAGAAGCAGACATGGG - Intronic
1117051366 14:51863263-51863285 AAGTAGTAAGAACCAGTAATAGG - Intronic
1117670203 14:58098742-58098764 AGGTAGGAAGAAGTAGGCAGGGG + Intronic
1118491342 14:66263604-66263626 AAGAAACAAGATGCTGGCATTGG - Intergenic
1119895455 14:78215853-78215875 AAGAAGGAAGAAGCAGGAACGGG - Intergenic
1120735692 14:88049504-88049526 AAATAGCAAGAATAAAGCATAGG + Intergenic
1120841435 14:89088945-89088967 AAGTGACAAGAAGCAGCCAGTGG + Intergenic
1126028190 15:44469379-44469401 AAGTAGCAAGCTACAGCCATAGG - Intronic
1127874411 15:63099386-63099408 GTGTAGAAAGAAGCAGACATGGG + Intergenic
1129475788 15:75783825-75783847 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1129728892 15:77918264-77918286 AGGAAGCAAGAAACAGTCATAGG + Intergenic
1130124710 15:81083628-81083650 GATTAGCAAAAAGCAGGCCTAGG - Intronic
1130259443 15:82344100-82344122 AGGAAGCAAGAAACAGTCATAGG + Intronic
1130269235 15:82435068-82435090 AGGAAGCAAGAAACAGTCATAGG - Intronic
1130281823 15:82525085-82525107 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1130473190 15:84241248-84241270 AGGAAGCAAGAAACAGTCATAGG - Intronic
1130480605 15:84355313-84355335 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1130484800 15:84392749-84392771 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1130491107 15:84432446-84432468 AGGAAGCAAGAAACAGTCATAGG + Intergenic
1130502691 15:84511246-84511268 AGGAAGCAAGAAACAGTCATAGG + Intergenic
1130595475 15:85245838-85245860 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1131043711 15:89296581-89296603 ATGTAGAAAGAAGTAGACATGGG - Intronic
1131132456 15:89909034-89909056 AAATACCATGAAGCAGGAATGGG + Intronic
1131188111 15:90292600-90292622 AGGAAGCAAGAAACAGTCATAGG - Intronic
1131980785 15:97992524-97992546 TAGGTGCAAGAAGCAGGCAAGGG - Intergenic
1132783867 16:1643585-1643607 GAAGGGCAAGAAGCAGGCATGGG + Intronic
1133101715 16:3484070-3484092 AAGGAGGAAGAAGCAGGGAAGGG - Intronic
1136536294 16:30901883-30901905 AGGGAGGAAGAAACAGGCATTGG + Intronic
1137715549 16:50596113-50596135 GAGCAGTGAGAAGCAGGCATGGG + Intronic
1137854936 16:51785079-51785101 AAGTAGCTAGTAGCAGGCGGAGG + Intergenic
1138629149 16:58279772-58279794 AAGTAGCCAGAGGCAGGCCACGG + Exonic
1139187291 16:64821950-64821972 AAGCATCAAGCCGCAGGCATGGG - Intergenic
1139385225 16:66564121-66564143 AAGAAGGAAGGACCAGGCATAGG + Intronic
1140637489 16:76932504-76932526 AAATATATAGAAGCAGGCATTGG + Intergenic
1140749122 16:78007447-78007469 AAGAAGTAAGGAGCAGTCATTGG + Intergenic
1141317522 16:82976334-82976356 AGGTAGGAAGAGGGAGGCATAGG - Intronic
1141368069 16:83462626-83462648 GAGTAGCAAGTTGCAGGCATGGG - Intronic
1145934180 17:28705426-28705448 AAGGATCAAGAAGGGGGCATGGG - Intronic
1146595281 17:34162990-34163012 AAGTGGAGAGAAGCCGGCATGGG - Intronic
1149092145 17:52796369-52796391 AAGTAGAAAATAGCAGGCGTTGG - Intergenic
1149282754 17:55126473-55126495 AAGTAGAAATAAACAGGAATGGG + Intronic
1153751203 18:8232649-8232671 AAGTAGCAAGTACCAGAGATGGG + Intronic
1153764794 18:8365274-8365296 AAGAAGCAACAGGCAGGCCTAGG - Intronic
1155182017 18:23356181-23356203 AAGGAGCAAGAAGGAGGCCAAGG + Intronic
1155831469 18:30520406-30520428 AAGTAACTAGGAGCAGGCAAAGG - Intergenic
1156021942 18:32609527-32609549 AAGAAGCAAGAAGCAAACAATGG + Intergenic
1157268254 18:46247966-46247988 AAGAAGCAAGAAGCTGGATTGGG - Intronic
1158488552 18:57889642-57889664 AATTTGCAAGAAGCAGAGATAGG - Intergenic
1158610126 18:58932169-58932191 AAGGAGAAAGAGGGAGGCATAGG - Intronic
1158981987 18:62771889-62771911 AAGATGCCAGAAGCAGGCAATGG - Intronic
1160154413 18:76422667-76422689 AAGGGGCAAGAAGCAGGGACGGG + Intronic
1160566010 18:79787154-79787176 AATTACCAAGAAGCAGGAAGGGG + Intergenic
1160731356 19:643011-643033 GAGGAGCAAGGAGCAGGCAGAGG - Intronic
1163986035 19:20952435-20952457 ATGTAGAAAGAAGTAGACATGGG - Intergenic
1167262157 19:48464820-48464842 AGGTAGCAAGATGGAGGGATGGG + Exonic
1167717749 19:51154831-51154853 AATTAGAAAGATGCAGGGATGGG - Intergenic
925521514 2:4751336-4751358 AAGTTGAAAGAAGGAGGCAGTGG + Intergenic
926096776 2:10086412-10086434 AAGCAGGAAGAAGTAGGCAGGGG - Intergenic
926647986 2:15310726-15310748 AAGGAGCCAGGAGAAGGCATGGG - Intronic
927142731 2:20140993-20141015 GAGAAGTGAGAAGCAGGCATGGG + Intergenic
927725555 2:25419708-25419730 ACGAAGCAAGCAGCAGGCCTCGG + Intronic
927874611 2:26647227-26647249 GTGTGGCAAGAAGCAGGCCTCGG + Intergenic
928312275 2:30220864-30220886 AAGAAGGAAGAAGCGGGCTTGGG - Intergenic
929607507 2:43244762-43244784 AATCATCAAGGAGCAGGCATAGG - Intronic
934734873 2:96685103-96685125 AGGTGGCAAGAAGCCGGGATGGG - Intergenic
935664650 2:105499771-105499793 AAGAACCAAGAAGTGGGCATGGG + Intergenic
937121495 2:119442479-119442501 AAGTAGCTACAGGCAGGCCTGGG - Intronic
938254918 2:129849845-129849867 AAGGAGCAAGAAGCAAGCATGGG + Intergenic
939211744 2:139184053-139184075 AAGTAACAAGAAGCTGGCCCTGG - Intergenic
940303330 2:152198847-152198869 AAGATGCAAGGAGGAGGCATGGG - Intergenic
941292291 2:163692229-163692251 ATTCAGTAAGAAGCAGGCATAGG + Intronic
942220813 2:173767365-173767387 AAAGAGCAAGAAGCAGGAGTTGG + Intergenic
943456534 2:188115036-188115058 AAGTAACAAGATGCAAGAATAGG + Intergenic
943648218 2:190430592-190430614 GTGTAGAAAGAAGCAGACATGGG - Intronic
944820239 2:203422602-203422624 AAATGTCAAGAAGCAGGCAGAGG + Intronic
947981993 2:234418529-234418551 ATGAAGAAAGAAGCAGGCAGGGG - Intergenic
948123053 2:235545062-235545084 AAGTAGCAAGAACCAGGGTAAGG - Intronic
948214271 2:236216940-236216962 AAGGAGCAAGCAGAGGGCATGGG - Intronic
948581432 2:238989557-238989579 AAGACGCAAGCATCAGGCATGGG + Intergenic
1170664506 20:18375466-18375488 ATGTAGAAAGAAGTAGACATAGG - Intergenic
1171091934 20:22293515-22293537 AAGTAAAAAGATGCAGCCATTGG + Intergenic
1171300657 20:24057543-24057565 AATTAGAAAGTAGCAAGCATTGG + Intergenic
1171376313 20:24696396-24696418 CAGTGGCAAGAAGGGGGCATTGG + Intergenic
1171865855 20:30487235-30487257 GAGAGGCAAGAAGCAGGGATGGG + Intergenic
1174388267 20:50199848-50199870 AAGTAGAAAGAAGCAGGGGCTGG - Intergenic
1174574939 20:51530626-51530648 AAGAAGATAGAAGCAGGGATGGG + Intronic
1174631282 20:51960306-51960328 CATTAGCATGCAGCAGGCATGGG + Intergenic
1176364811 21:6026418-6026440 AAGTAGAAACATGCAGGCAAGGG - Intergenic
1179490203 21:41736317-41736339 AAGAAGGGAGAAGCAGGGATTGG + Intergenic
1179758707 21:43512127-43512149 AAGTAGAAACATGCAGGCAAGGG + Intergenic
1182951929 22:34384248-34384270 CAGTCGTAAGAGGCAGGCATGGG + Intergenic
1182955991 22:34426932-34426954 AAGTAGGGAAAAGCAGGCCTAGG + Intergenic
1184672540 22:46022852-46022874 TAGTACAAAGCAGCAGGCATTGG - Intergenic
950053288 3:10007938-10007960 AGGAAGCAAGAAGCAGGCTCAGG + Intronic
950276786 3:11668381-11668403 TAGTAGCAAGGAGAAGGGATTGG - Intronic
950304930 3:11910223-11910245 AGGAAGCAAGAAGCAGGCTCAGG + Intergenic
951088818 3:18547495-18547517 CTGTAGAAAGAATCAGGCATTGG + Intergenic
951273612 3:20658075-20658097 AAGTAGAAGGAAGCAGGAAAAGG - Intergenic
952210793 3:31227310-31227332 AAAAAGGAAGAAGCATGCATGGG - Intergenic
953414342 3:42707096-42707118 AGGGAGTGAGAAGCAGGCATAGG - Intronic
953782467 3:45883863-45883885 AAGCAGCTAGAAGCAGGCCCAGG + Intronic
954332244 3:49897255-49897277 AAGTACCACCAGGCAGGCATGGG - Intronic
955678532 3:61475391-61475413 AAGGAGGAGGAAGCAGGAATGGG - Intergenic
955792497 3:62602999-62603021 AAGTACCAGGAAGCAGGCGGGGG + Intronic
956742519 3:72286444-72286466 GAGTAGCATGGAGCAGACATTGG - Intergenic
956945077 3:74212281-74212303 AAGTAGCATGAAGATGGCAAAGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958405935 3:93760040-93760062 GAGTAGAAAGAAGTAGACATAGG - Intergenic
958698980 3:97564281-97564303 AAGGAGCAAGAAGTTTGCATGGG + Intronic
958721226 3:97846252-97846274 AAGTAGCCAGAGGTAGGGATGGG - Intronic
958809258 3:98840779-98840801 ACGTAGCAAATAACAGGCATGGG - Intronic
960691659 3:120352439-120352461 AATCAGAAAGAAGCAGACATGGG + Intergenic
961296703 3:125890499-125890521 GTGTAGAAAGAAGTAGGCATAGG + Intergenic
962867791 3:139461926-139461948 TAGTAGGAAGAGGCAGGCCTAGG - Intronic
963923777 3:150930198-150930220 AAGTAGCCAGAAGGAGCTATAGG + Intronic
964904689 3:161706132-161706154 AAGAATCCAGAAGCAGGCCTTGG - Intergenic
965121092 3:164558613-164558635 AAGTGGCAAGCAGCAGGTGTTGG - Intergenic
965747435 3:171939961-171939983 AAGTGGGAATAAGGAGGCATGGG + Intergenic
966095206 3:176191961-176191983 GAGTAGCAAGAACCCTGCATTGG - Intergenic
967158705 3:186716778-186716800 AACCAGAAAGAAGCAAGCATAGG + Intergenic
968666914 4:1827675-1827697 GTGTAGAAAGAAGTAGGCATGGG - Intronic
969320495 4:6409614-6409636 GAGTAGCAAGAGGGAGGCACAGG + Intronic
969455319 4:7296939-7296961 AAGGAGCACGAAGCTGGCCTGGG - Intronic
971455383 4:26839516-26839538 AAGGAGCATGAGGGAGGCATAGG + Intergenic
972195710 4:36651344-36651366 AGGTAGTCAGGAGCAGGCATAGG + Intergenic
973655246 4:53040700-53040722 AATGAGTAAGAAGCATGCATTGG - Intronic
975795872 4:78006951-78006973 GTGTAGCAAGAAGTAGACATAGG - Intergenic
976087982 4:81425737-81425759 CAGGAGCAAGAAGAAAGCATAGG - Intergenic
977895712 4:102362465-102362487 AAGTAGTAAGAAGCTGGAAGTGG - Intronic
978721731 4:111917919-111917941 GAGTAGGAAGAAGCAGGATTGGG + Intergenic
981164695 4:141543710-141543732 AAGTAGCTTGAAGCAGGAATGGG - Intergenic
981879288 4:149590431-149590453 AAGTTGAAAGAAGCAGGTAGTGG - Intergenic
982876857 4:160661224-160661246 GAGTAGAAAGAAGTAGACATAGG - Intergenic
984915313 4:184718336-184718358 AAGTTGGAAGAAGCAGGATTGGG - Intronic
986253361 5:6081436-6081458 AAGTAGCAGGCAGATGGCATTGG - Intergenic
988035428 5:25822367-25822389 AAGTAAACAGAAGCAGACATAGG + Intergenic
988178831 5:27763486-27763508 AAGTGGCAGGAAGCAGACACTGG + Intergenic
989071745 5:37519073-37519095 ATGTAGAAAGAAGTAGACATAGG - Intronic
989712881 5:44422325-44422347 AATTATAAAGAAGCAGGGATGGG + Intergenic
990095679 5:52109320-52109342 AAGTAGCCAGATACAGGAATGGG - Intergenic
990787603 5:59439856-59439878 AAGCAGCTAGGTGCAGGCATGGG + Intronic
991478344 5:67048036-67048058 AAGCAGCAATAAGCAGGATTTGG + Intronic
992474198 5:77086876-77086898 AAGGAGCAAGAATGAGGCACTGG + Intronic
993887300 5:93430480-93430502 AAGAAACAAAAAGGAGGCATTGG + Intergenic
993934838 5:93986624-93986646 ATGTAGAAAGAAGTAGACATAGG + Intronic
994560663 5:101366948-101366970 AATTAAGAAAAAGCAGGCATAGG + Intergenic
995412667 5:111876191-111876213 AGGAAGCTAGAAGCATGCATGGG - Intronic
997059698 5:130487052-130487074 AAGTAGCAATAATCATACATTGG - Intergenic
997321522 5:132982779-132982801 GTGTAGCAAGAAGTAGACATGGG - Intergenic
997336077 5:133109382-133109404 GTGTAGAAAGAAGCAGACATGGG + Intergenic
999131821 5:149289418-149289440 AAGTACTAAGACGAAGGCATTGG + Intronic
1000255869 5:159537716-159537738 AAGTAGAAAAATGAAGGCATTGG - Intergenic
1000588988 5:163135428-163135450 AAGAATCAAGAATAAGGCATGGG + Intergenic
1001447640 5:171798176-171798198 AAGTTGAAAGAACCAGGCTTTGG + Intergenic
1001471350 5:172015313-172015335 AAGTGGAAGGGAGCAGGCATTGG + Intergenic
1001758951 5:174191951-174191973 AAGATGCAGGAAGCAGGCAAGGG - Intronic
1003419649 6:5945596-5945618 AAGTGGCAAGAAGCATAGATAGG - Intergenic
1003899966 6:10645469-10645491 ATGTGGGAAGAAGCAGGCAGGGG + Intergenic
1005395808 6:25380888-25380910 AAGTAGCAAGAAACCTGCATTGG + Intronic
1005860266 6:29895556-29895578 GTGTAGAAAGAAGCAGACATAGG - Intergenic
1006574780 6:35037038-35037060 AACACGCAAGAACCAGGCATGGG + Intronic
1006796858 6:36737531-36737553 CAGGAGCAAGAGGCAGGCCTGGG - Intergenic
1006928423 6:37672483-37672505 AAGGAGCCAGAAGCAGGAAGAGG - Intronic
1007413076 6:41675973-41675995 AAGCACCAAGGAGCAGGCAGTGG - Intergenic
1007628989 6:43262380-43262402 AAGCAGCAGGAAGCAGCCACTGG + Intronic
1007833157 6:44654232-44654254 CAGTTGCAAGAAGCAGGAAGAGG + Intergenic
1009217942 6:60945274-60945296 GTGTAGAAAGAAGCAGACATAGG + Intergenic
1009828628 6:68900412-68900434 AAGTAGCCACAAGGAGGCCTGGG + Intronic
1010211807 6:73368070-73368092 ACGTTGCAAGAAGCAAGCCTGGG - Intergenic
1010619727 6:78059982-78060004 AAGAAGAAAGAAGCATCCATGGG + Intergenic
1010716792 6:79239437-79239459 CAGTAGCTAGAACCAGGGATTGG + Intergenic
1012393426 6:98769221-98769243 TAGGAGAAAGATGCAGGCATGGG + Intergenic
1013402800 6:109815334-109815356 AAGCAGGGAGAGGCAGGCATGGG - Intronic
1013638125 6:112047963-112047985 GTGTAGAAAGAAGTAGGCATGGG + Intergenic
1014136226 6:117893152-117893174 ATGTAGTATGAAGGAGGCATTGG + Intergenic
1015979157 6:138821495-138821517 AAGTGGCCAGAAGTGGGCATGGG - Intronic
1017452945 6:154571433-154571455 AAGTAGCAGGGAGAAGGCAACGG - Intergenic
1019518608 7:1450571-1450593 AGGTGGCAGGAAGCAGGCCTGGG + Intronic
1020245332 7:6424839-6424861 CAGGAGCAAGAAACAAGCATGGG + Intronic
1020965913 7:14868271-14868293 AAGTGGCAAGAGGCAAGCATAGG - Intronic
1021342819 7:19486191-19486213 AAGTTGCAAGAAGCAAGAAGGGG + Intergenic
1021651177 7:22835233-22835255 AAGTAGCAAGCAGCTGGACTAGG - Intergenic
1022040735 7:26579161-26579183 AAGAAGGAAGTAGCAGACATAGG + Intergenic
1022634186 7:32116446-32116468 AATAACCAAGAAGCAGGCAGGGG + Intronic
1022976987 7:35567726-35567748 ATGTGGGAAGAAGCAGGAATAGG + Intergenic
1023192139 7:37594062-37594084 AAGAAGCATGATGCTGGCATCGG - Intergenic
1023529225 7:41136074-41136096 AAGTAGCAAAGAGCAGGGAGGGG + Intergenic
1023907281 7:44531682-44531704 CAGTAGCAACCAGCAGGGATGGG - Intronic
1024212329 7:47216642-47216664 AAGAAGCAGGAAGCACTCATGGG - Intergenic
1024723728 7:52168724-52168746 AAGAAAAGAGAAGCAGGCATGGG + Intergenic
1024910828 7:54444731-54444753 GTGTAGAAAGAAGCAGACATGGG + Intergenic
1026808489 7:73443056-73443078 AAGCAGCAAAGAGCAGGCAGCGG + Intronic
1027816839 7:82984778-82984800 AAGTAGCAAGAAGCAGGCATAGG - Intronic
1027844618 7:83356839-83356861 ATGCAGAAAGAAGAAGGCATTGG + Intergenic
1029001652 7:97160510-97160532 ATGTAGAAAGAAGTAGACATAGG + Intronic
1029519484 7:101051063-101051085 AAGAGGGAAGAAGGAGGCATTGG + Intronic
1029795383 7:102889103-102889125 AAGAATCAAGAAGCAGGAGTAGG + Intronic
1030746186 7:113169547-113169569 AAATAGAAAGTAGAAGGCATGGG - Intergenic
1032591384 7:133194931-133194953 AAGAAGCAAGCATCTGGCATGGG - Intergenic
1032700779 7:134377260-134377282 AAGTAGCAAAAAGAGGGCAGAGG + Intergenic
1033585544 7:142771965-142771987 AATTAGCAGGAAGCAGCCACAGG + Intergenic
1034990203 7:155543153-155543175 AAGGAGAAAAAAGCAGGCAAGGG + Intergenic
1035733414 8:1869577-1869599 AAGTAGAGAGAATCAGGCAAAGG + Intronic
1036796053 8:11757574-11757596 AAGGAGGAGGAAGCTGGCATGGG + Intronic
1037074759 8:14700895-14700917 AGTTAGCAAGAAGCAGGAAAGGG + Intronic
1039407564 8:37326352-37326374 AGGCAGCCAGGAGCAGGCATAGG - Intergenic
1041783608 8:61606629-61606651 AATTATCATGAAGCAGGAATGGG + Intronic
1044631632 8:94285645-94285667 CAGAAGCAAGAAGCAGGGAATGG + Intergenic
1046318501 8:112538811-112538833 AAGGAGCAAGAAAATGGCATTGG - Intronic
1046599617 8:116300866-116300888 AAGAAGCAAGAAGAAAGAATGGG - Intergenic
1047057431 8:121181638-121181660 AAGTAGCAAGAAGGTGACAGTGG - Intergenic
1047619555 8:126592222-126592244 CAGTAGCAAGAAGCTCCCATGGG - Intergenic
1047630016 8:126696523-126696545 AGGTAGCAAGAAGAGGGCAGAGG - Intergenic
1048964693 8:139607224-139607246 AAGGAGCAGGGAGCAGGAATGGG - Intronic
1049211745 8:141389844-141389866 AAATAGCATGAAACAGGCAGGGG + Intergenic
1049975907 9:861452-861474 GTGTAGAAAGAAGCAGACATAGG - Intronic
1051405404 9:16732307-16732329 AAGTAGAAAGAAGAAAACATAGG - Intronic
1051563470 9:18469674-18469696 AGGTGTCAAGAGGCAGGCATGGG - Intergenic
1051986092 9:23089265-23089287 ATGTAACAAGAAGCAGCAATGGG - Intergenic
1052730857 9:32283542-32283564 AAATAGCAGGAAGCAAGCAAGGG + Intergenic
1053131105 9:35616351-35616373 AAGTTGCAAGAAGCAGAAAAAGG - Intronic
1053300637 9:36946841-36946863 AAGGAGCGGGAAGCAGCCATGGG - Intronic
1055390342 9:75815055-75815077 AATTGGAAAGAAGCAGGGATTGG + Intergenic
1056556747 9:87695692-87695714 AAGAAGCAAGAAGCATGCAGGGG - Intronic
1057986751 9:99724662-99724684 CAGAAGCAACAAGCAGGTATTGG - Intergenic
1059649409 9:116301557-116301579 AAATATCAAGAAACATGCATAGG + Intronic
1059768387 9:117405032-117405054 AAGCAGCAAGGAGCAAGCAAAGG + Intronic
1060361913 9:122967180-122967202 AAGTAACAAGATGCAGGCCTTGG + Intronic
1061242693 9:129383573-129383595 AGGCAGCAAGAAGCAGGAAAAGG + Intergenic
1187429760 X:19211333-19211355 AAGCAGCAAGAAAGAAGCATTGG + Intergenic
1188687258 X:33083942-33083964 CAGGAGAATGAAGCAGGCATTGG + Intronic
1188824805 X:34818561-34818583 AAGTAGCAACAATCAGGCCAAGG - Intergenic
1190608442 X:52169617-52169639 CAGGAGCAGGAAGAAGGCATAGG - Intergenic
1194019715 X:88672243-88672265 AAGTAGTAATAATCAGTCATTGG - Intergenic
1194585341 X:95726307-95726329 AAGTAGCAGAAAGCAGGCAGGGG + Intergenic
1196583779 X:117405913-117405935 AACTAGCAAGAAACAGGCACGGG + Intergenic
1199570537 X:149263027-149263049 AAGTGGCATTAGGCAGGCATGGG - Intergenic
1200952820 Y:8917871-8917893 GTGTAGAAAGAAGCAGACATGGG - Intergenic
1201948354 Y:19536030-19536052 GTGTAGCAAGAAGTAGACATGGG + Intergenic
1202330471 Y:23747470-23747492 AGGAAGCTAGAAGCAGACATGGG + Intergenic
1202347761 Y:23953075-23953097 AGGAAGCTAGAAGCAGACATGGG + Intergenic
1202373298 Y:24212538-24212560 AGGAAGCAAGAAACAGTCATAGG + Intergenic
1202497484 Y:25457582-25457604 AGGAAGCAAGAAACAGTCATAGG - Intergenic
1202523012 Y:25717016-25717038 AGGAAGCTAGAAGCAGACATGGG - Intergenic
1202540298 Y:25922591-25922613 AGGAAGCTAGAAGCAGACATGGG - Intergenic