ID: 1027818198

View in Genome Browser
Species Human (GRCh38)
Location 7:83006494-83006516
Sequence ATGAAACAGCAGTATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027818198_1027818199 26 Left 1027818198 7:83006494-83006516 CCTTTCTCATACTGCTGTTTCAT 0: 1
1: 0
2: 4
3: 36
4: 393
Right 1027818199 7:83006543-83006565 ATTATTCCTTCATTGAACCTTGG 0: 1
1: 0
2: 1
3: 20
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027818198 Original CRISPR ATGAAACAGCAGTATGAGAA AGG (reversed) Intronic
900123039 1:1057396-1057418 AAGAGACAGCAGTTTGCGAAGGG - Intergenic
900816782 1:4853366-4853388 ACGAGACAGCAGTATGAGGATGG - Intergenic
901939659 1:12652317-12652339 AGGAAACAGCAGGTAGAGAACGG - Intronic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
905011508 1:34750253-34750275 AGGAAACATCAGCATGGGAATGG + Intronic
905066130 1:35184800-35184822 TTGAAACAGGTGTATGAGAATGG - Intronic
905396397 1:37669329-37669351 AGAAGACAGCAGCATGAGAAGGG - Intergenic
907654719 1:56330689-56330711 ATGAAAAAGTATTATAAGAAAGG - Intergenic
907891103 1:58636978-58637000 ATTTATCAGCAGTATGAAAAAGG + Intergenic
908257892 1:62317986-62318008 TTGAAAAGGCAGTATTAGAACGG + Intronic
909116319 1:71541644-71541666 ATGGAACAGCAGGAACAGAACGG + Intronic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
909312592 1:74172234-74172256 AAGTAAAAGCAGTATGATAAGGG - Intronic
909545982 1:76846897-76846919 ATGAAAAGGCAATATGGGAAGGG - Intergenic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910027824 1:82679591-82679613 TTATAACACCAGTATGAGAATGG + Intergenic
910406643 1:86898314-86898336 ATCAATCAGCAGAATGACAAGGG + Intronic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
910643659 1:89490455-89490477 CTTAATCAGCAGCATGAGAATGG - Intergenic
911708190 1:101039791-101039813 ATGCAACAGCACTAGGGGAATGG + Intergenic
911858432 1:102912980-102913002 ACCTCACAGCAGTATGAGAATGG + Intronic
913396611 1:118378425-118378447 ATGAAACAGCACTAGGGGAATGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
917668756 1:177251455-177251477 TAGAAACAGCAGTATGATATTGG + Intronic
917762390 1:178176491-178176513 GTGAAAGAGAACTATGAGAATGG - Intronic
918877168 1:190062654-190062676 ATGAGAGAGCAGGATGATAAGGG + Intergenic
919032716 1:192264868-192264890 ATCAAACAGCAACATAAGAAAGG - Intergenic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
921750933 1:218793636-218793658 ATGAAACACCAATATGCGACTGG - Intergenic
922050472 1:221984939-221984961 ATGAATCAGCAGTTTAAAAATGG + Intergenic
923155716 1:231277429-231277451 AAGGAACAGCTGTATGAGGAAGG + Intronic
923258545 1:232243794-232243816 AGGAAACAGCAGAAAGAGCATGG + Intergenic
923643965 1:235796431-235796453 ATGAATCACCAGTATAAAAATGG + Intronic
924253983 1:242163798-242163820 ATCAAAGAGCAGGATGAGCAGGG + Intronic
1062969716 10:1637700-1637722 ATGAAACTGCAGTTTAAGAGTGG - Intronic
1064750263 10:18521382-18521404 ATGACACAGCATTATGTGTAAGG + Intronic
1065043227 10:21718393-21718415 AGGAAACAGCAGGATTTGAAAGG - Intronic
1065389769 10:25171202-25171224 ATGAAAAAGCAGTATGTAATGGG - Intergenic
1066332811 10:34443391-34443413 ATTTATCAGCAGCATGAGAACGG - Intronic
1067657661 10:48209023-48209045 ACTGAACAGCATTATGAGAAGGG - Intronic
1068030802 10:51702461-51702483 ATAAAAAAGCAGTATAAAAATGG - Intronic
1068589285 10:58837258-58837280 ATAAAACAGCAGGAAGGGAAAGG + Intergenic
1069267146 10:66474040-66474062 ATGTTATAGCAGTGTGAGAATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070905978 10:80073502-80073524 TTGAAACAGTATAATGAGAATGG - Intergenic
1071691992 10:87830184-87830206 ATGAAATAGCAGTATAGTAAGGG + Intronic
1071795659 10:89002368-89002390 AGGAGACAGTATTATGAGAAGGG - Intronic
1072649028 10:97279017-97279039 TTGAAAAAGCAGTAAGAGAGAGG - Intronic
1072815767 10:98507584-98507606 ATGAAAAAGGAGTCTGAAAATGG - Intronic
1072969293 10:100003040-100003062 ATGAATAAGAAGTATAAGAATGG + Intronic
1073346844 10:102789678-102789700 ATGAAACTGCAGAGTGACAAAGG - Intronic
1073370587 10:102985260-102985282 ATGAAACAAGAGGGTGAGAAGGG - Intronic
1075073239 10:119332923-119332945 AATAAACAGCACTATGGGAAAGG - Intronic
1075689918 10:124387788-124387810 AGGAAACAGCAGAAACAGAAAGG + Intergenic
1075749282 10:124752043-124752065 GTGAAACAGAAGTATGTTAAAGG - Intronic
1077059144 11:610131-610153 ATGAAACAGCATTCTGGGCAGGG + Intronic
1077615650 11:3671717-3671739 ATGAAACAGAAGTAGGAGAAAGG - Intronic
1079888976 11:26026476-26026498 CTGAATCAGCAATCTGAGAATGG - Intergenic
1080344354 11:31307800-31307822 ATTCAGCAGCAGTATCAGAAGGG - Exonic
1080929931 11:36799395-36799417 ATGAAGCATCAGGATCAGAATGG - Intergenic
1080960830 11:37157848-37157870 ATGAATCTTCAGTAAGAGAAGGG + Intergenic
1081031819 11:38094004-38094026 AAGAAAGAGCAGAATAAGAATGG + Intergenic
1081485621 11:43525706-43525728 ATGAGACAGCACTAGGAAAATGG - Intergenic
1082824750 11:57569286-57569308 AGGAAACACCAGGATGAGAAAGG + Intergenic
1085344743 11:75761323-75761345 AGGAAAATGCAGTATGAGCAAGG - Intronic
1086147901 11:83574160-83574182 ATGAAACTGGAGTTGGAGAAAGG + Intronic
1087094893 11:94308648-94308670 ATGAAAAAGAAGTAAGAAAAAGG + Intergenic
1087571212 11:99929439-99929461 TTGTCACAGCAGCATGAGAATGG - Intronic
1089489397 11:118872439-118872461 ATGACACAGCAGTAGGGGACAGG - Intergenic
1090085576 11:123647538-123647560 ATGAAAAAGTAGCATCAGAAGGG - Intronic
1090634512 11:128682358-128682380 ATGAAACAGGAGCAAGAGAGAGG - Intergenic
1091779294 12:3203940-3203962 AGGAAAGAGCAGAATGGGAAGGG + Intronic
1092775636 12:11942949-11942971 ATGAGAAAGCAGTAGGAGCAAGG + Intergenic
1093035283 12:14326760-14326782 ATGAAAGAGCAGCATGAGCCAGG - Intergenic
1093955195 12:25208923-25208945 ATGAAAGAGCAGTCTGACACAGG + Intronic
1095218465 12:39578583-39578605 ATGAATCAGGAGAATCAGAAGGG + Intronic
1097732698 12:63147974-63147996 ATGACACAGCAGTTACAGAATGG + Intronic
1098986725 12:77020279-77020301 ATTTATCAGCAGCATGAGAATGG - Intergenic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1099815565 12:87642809-87642831 ATAAATCAGGAGTATGAGTAAGG + Intergenic
1099931119 12:89076163-89076185 ATGAAATTGAAGCATGAGAATGG + Intergenic
1101656661 12:106727497-106727519 ATGAAATAGAAGAATTAGAAAGG + Intronic
1102196622 12:111030008-111030030 ATTAAACAGCACTAGGAGTAAGG - Intergenic
1102747971 12:115266683-115266705 AAGATACAGCACTATGAGATAGG - Intergenic
1103384089 12:120518115-120518137 CGGAAACAGCATTATAAGAAAGG - Intronic
1104124005 12:125827977-125827999 ATTAAACAGGTGTATGATAAAGG + Intergenic
1104132292 12:125905965-125905987 GTGAATCAGCAGTGTGAAAAAGG - Intergenic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106866557 13:33970618-33970640 AGGAAACACCAGTAGGGGAAAGG + Intergenic
1107062474 13:36174464-36174486 ATGGCACAGCGGTATGATAAGGG - Exonic
1107520237 13:41172954-41172976 ATAAAACAGCAATAGTAGAATGG - Intergenic
1107568685 13:41633062-41633084 ATGAAACAGCACTTGGAGCATGG + Intronic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1108092087 13:46859558-46859580 ATGAAACAGCACTAGGGGGATGG - Intronic
1108110585 13:47067462-47067484 AGGCAACAGCAGCATGAGAATGG + Intergenic
1108162763 13:47659911-47659933 ATGAATCGGGAGTATGAGAAAGG + Intergenic
1109121285 13:58461371-58461393 AGGAAACAGCAATATGTGACAGG + Intergenic
1109456428 13:62597458-62597480 AGGAAACAGCAGTCAGAGAATGG + Intergenic
1110034142 13:70657402-70657424 CTTTATCAGCAGTATGAGAAAGG + Intergenic
1110547488 13:76772163-76772185 ATGAGACAGCACTACGAGAAAGG + Intergenic
1111260822 13:85737755-85737777 ATGTATTAGCAGTGTGAGAATGG + Intergenic
1111588009 13:90307455-90307477 ATACTACAGCAGTGTGAGAATGG + Intergenic
1111637293 13:90921596-90921618 AAGAAACAGCCGTAAAAGAAAGG + Intergenic
1111843849 13:93485005-93485027 ATTAAACAGCAGTATGGTAAAGG + Intronic
1113114484 13:106860819-106860841 AGAAAACAGCAGTAGCAGAAGGG + Intergenic
1113372425 13:109735323-109735345 ATGAAACAACAGTTTGAGTCAGG - Intergenic
1113677967 13:112221503-112221525 ATGACACAGAAGTTGGAGAACGG - Intergenic
1114526379 14:23369202-23369224 ATGAAACAGCATTATGAGATAGG - Intergenic
1114719159 14:24861887-24861909 AAGAAACAGAAGGAGGAGAAGGG - Intronic
1115358942 14:32479967-32479989 ATCACACACCAGTATGAGGAAGG - Intronic
1115523292 14:34254419-34254441 ATGGAACAGTAGGATGATAAAGG + Intronic
1116095923 14:40367270-40367292 ATGTAACAGCATTAAGAGATGGG - Intergenic
1116897950 14:50335449-50335471 TTTAAACAGCAGGCTGAGAAGGG - Intronic
1117056166 14:51913935-51913957 ATGAAACATATGTATGAAAAAGG - Intronic
1117564445 14:56978811-56978833 AAGAAATGGCAGGATGAGAATGG + Intergenic
1120230399 14:81835419-81835441 ATGAAACAGCACTAGGGGGATGG - Intergenic
1120502205 14:85310765-85310787 ATGAGACAGCACTAGGGGAATGG + Intergenic
1121063295 14:90937553-90937575 ATTTATCAGCAGTGTGAGAATGG - Intronic
1121684589 14:95826077-95826099 ATGAATCAGAAGTAAGAGAAAGG + Intergenic
1121885544 14:97539458-97539480 TTTATACAGCAGCATGAGAATGG + Intergenic
1124058930 15:26269567-26269589 ATGTAACAGAAGCACGAGAATGG - Intergenic
1125711264 15:41788715-41788737 AGGAAATAGAATTATGAGAAGGG + Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127188715 15:56507093-56507115 AGGAAGCTGCAGTATGAGAAGGG - Intergenic
1128258351 15:66214522-66214544 ATGACACAGCAGAAGAAGAAGGG + Intronic
1128608246 15:69054397-69054419 ATGAAACAGCACTTTAGGAAGGG - Intronic
1129805862 15:78456888-78456910 AAGAAAGAGTAGTATAAGAAGGG - Intronic
1131500062 15:92953770-92953792 AAGCAACAGCAGTATGTGAGTGG + Intronic
1131908953 15:97174834-97174856 ATGAAACAGCAGAAAGACTAGGG - Intergenic
1134809472 16:17154986-17155008 ATGAAATACCAGAATGGGAAGGG + Intronic
1134870804 16:17650772-17650794 ATGGAACACCAGCATGAGAAAGG + Intergenic
1135037714 16:19091901-19091923 ATGTATTAGCAGCATGAGAACGG + Intergenic
1135174590 16:20216663-20216685 ATAAAACATCAGAATGAGACTGG - Intergenic
1136471913 16:30486569-30486591 TTCAAACAGCAATGTGAGAAAGG + Intronic
1137900480 16:52262419-52262441 ATGTAAAGGCATTATGAGAAGGG + Intergenic
1138101806 16:54257945-54257967 ATTTAGCAGCAGTATGAAAACGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138442802 16:57045413-57045435 AGGAAGCAGCAGTTTGAAAATGG - Intronic
1138965925 16:62084060-62084082 TTGAAAGAGTAGTATAAGAAAGG - Intergenic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1139569525 16:67802333-67802355 AGGAAACATCAGTTTTAGAAAGG - Intronic
1139936649 16:70576438-70576460 ATGAGACTGCAGTCAGAGAAGGG - Exonic
1140725140 16:77805062-77805084 ATGAGCCAGCAGTGTGGGAAGGG + Intronic
1140972284 16:80024935-80024957 ATGGAACAGGAGTATCAGTAAGG + Intergenic
1141263952 16:82479106-82479128 ATGAAACACCAGAGTGGGAAGGG - Intergenic
1144009991 17:11138253-11138275 ATGACTCAGCAATAGGAGAAAGG + Intergenic
1144329934 17:14213985-14214007 AGGAAACAGCGCTATGGGAATGG - Intergenic
1144995614 17:19266077-19266099 ATCAAGCAGCAGTGGGAGAAAGG - Intronic
1146334932 17:31961239-31961261 AAGAAACACTAGTATGATAATGG + Intronic
1149009077 17:51836371-51836393 ATGTAAAAGCACTTTGAGAAAGG + Intronic
1149632394 17:58137277-58137299 AAGTAACAGCAGTTTGAGGAAGG - Intergenic
1149775095 17:59351064-59351086 ATGGAACAGGAGTATTAGAAAGG + Intronic
1150461640 17:65358695-65358717 ATGAAACAGCACTAGGAGGATGG + Intergenic
1153801920 18:8678718-8678740 ATGAAAGAACAGTGTGAGCAGGG - Intergenic
1154099846 18:11462488-11462510 ATGAGACAGCACTAGGGGAAGGG - Intergenic
1154203245 18:12314698-12314720 ATGAAACAACAGTAAAAGACAGG + Intronic
1155170727 18:23265220-23265242 ATGAGAGAGCAGGAGGAGAACGG + Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1156654695 18:39271439-39271461 TAGAAACAGCAATAGGAGAAGGG - Intergenic
1156749677 18:40436361-40436383 TTTAATCAGCAGTATGAAAACGG + Intergenic
1157929670 18:51807889-51807911 ATGCAACAGCAGTATAAGACAGG + Intergenic
1158038080 18:53058925-53058947 ATTTATCAGCAGCATGAGAATGG - Intronic
1158396144 18:57079602-57079624 ATGTACCAGGAGCATGAGAATGG - Intergenic
1158419577 18:57280825-57280847 ATGAAACTTCTGTATGAAAATGG + Intergenic
1158545040 18:58389042-58389064 ATGTAAAAGCAGGATGTGAAAGG - Intronic
1159361229 18:67405936-67405958 ATGGGACAGCACTATGTGAAAGG + Intergenic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1162950571 19:14069861-14069883 GTGAAACAGAAGTCTGAGAAGGG + Intergenic
1164197003 19:22977205-22977227 ATGACACTGCAGTATGACACAGG + Intronic
1164475709 19:28574434-28574456 ATGAGACAGCAGTAGGGGAATGG - Intergenic
1166388077 19:42393111-42393133 AGGAAACAGCAGGTTGAGGAAGG - Intergenic
926821954 2:16861623-16861645 ATGAATCATCACTCTGAGAAAGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
928357846 2:30636803-30636825 AGGAACCACCTGTATGAGAAAGG + Intronic
930135632 2:47901873-47901895 ATGAAACAGTAGTGTGGGATTGG - Intronic
930453524 2:51575787-51575809 ATGAGACAGGAGTAAGAGAAAGG + Intergenic
931451143 2:62368764-62368786 AAGACATAGCAGTATGAGACTGG + Intergenic
931709506 2:64976375-64976397 ATGGTACAGCAGTATGATATAGG - Intergenic
932844323 2:75119866-75119888 AAGAAACACCAGTAGGAAAAGGG + Intronic
933408568 2:81895336-81895358 ATGAAATAGAAGTAGGAAAAAGG - Intergenic
934883461 2:98004381-98004403 AAAAAACAGCAGCCTGAGAAAGG + Intergenic
935287875 2:101581255-101581277 ATGAAACAGCAGTGTGACATGGG + Intergenic
935785731 2:106547166-106547188 ATGAATCTGCAGTTTGAGGAGGG + Intergenic
937104228 2:119295023-119295045 AGGAGACAGCAGTCAGAGAACGG + Intergenic
937176927 2:119947281-119947303 ATGAACCAGCAGCCTGAGAGAGG + Intronic
937570402 2:123351226-123351248 ATGAGACAGCACTAGGAGGATGG - Intergenic
939114788 2:138048320-138048342 CTGAAACAGAAGGATTAGAAAGG - Intergenic
939160313 2:138580488-138580510 ATTAAACAGCATAATGAAAAAGG - Intergenic
939462075 2:142509990-142510012 ATGAAACATGAGTTTGAGTAAGG - Intergenic
939817726 2:146916905-146916927 ATGAAACAGTAATAAGAAAAGGG + Intergenic
940147772 2:150565300-150565322 GTGAAACAGCAGAAGGATAAAGG + Intergenic
940339368 2:152563750-152563772 AGGAGACAGCAGGATGAGAAAGG - Intronic
940841084 2:158582659-158582681 ATCATACAGCAGTATGTTAATGG - Intronic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
942033799 2:171990770-171990792 ATGAAAGAACAGTATGAAAAAGG + Intronic
942539223 2:176998067-176998089 ATGAAATAACATTATGTGAAGGG - Intergenic
942881044 2:180860628-180860650 AGGAAAAAGGAGAATGAGAAAGG + Intergenic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
945904641 2:215577727-215577749 GTCAAACAGCAGTAATAGAAAGG + Intergenic
946115202 2:217455315-217455337 AAGACAGAGCAGTGTGAGAAGGG + Intronic
946618772 2:221538139-221538161 ATGAAACAGATGTATGAGTAGGG + Intronic
946935922 2:224720723-224720745 ATGAGACAGCACTAGGGGAATGG - Intergenic
947091777 2:226520263-226520285 ATAAAACAGCACTATGGGGATGG + Intergenic
947293159 2:228599909-228599931 ATGAGACAGCACTAGGGGAATGG + Intergenic
947576851 2:231282056-231282078 AAGATACAGCCGTATGTGAATGG + Exonic
947653411 2:231806622-231806644 AAGAAACAGCAGGAAGAGGATGG - Intronic
947660525 2:231863146-231863168 ATGAAACACAAGTAAGGGAATGG - Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1169499118 20:6142085-6142107 ATGCAACAGCAGTGAGAGAAAGG - Intergenic
1169573068 20:6927403-6927425 ATGAAGCAGATGTCTGAGAAAGG - Intergenic
1170275091 20:14576766-14576788 ATGAAAAAGCAGTGTTAAAAAGG + Intronic
1170323787 20:15133232-15133254 AGGAGAAAACAGTATGAGAAAGG + Intronic
1170480926 20:16764190-16764212 AAGAAACATCAGTAGGAGAGTGG - Intronic
1170750459 20:19140393-19140415 TTCTTACAGCAGTATGAGAATGG - Intergenic
1172651801 20:36508395-36508417 CTGAAACATCAGTAGGAAAATGG - Intronic
1176165211 20:63669475-63669497 ATGAAAAAGCAGTTAAAGAAAGG + Intronic
1176961051 21:15159098-15159120 ATTTATCAGCAGTATGAAAATGG + Intergenic
1177271736 21:18857579-18857601 ATAAAAAAGCAGTATCAGAAGGG + Intergenic
1177446578 21:21204689-21204711 ATGTATCAGCAGTCTGATAAAGG - Intronic
1177500566 21:21949634-21949656 ATGTAACAGCATTAAGAGAAGGG + Intergenic
1177602544 21:23334981-23335003 ATGAAACAGCACTAGGGGATTGG - Intergenic
1177870524 21:26567347-26567369 ATAAAACAGTACTATGTGAAGGG + Intronic
1179057976 21:37953600-37953622 AAGAAACAGAAGTATAAGAGAGG + Intronic
1179080397 21:38165595-38165617 GTGAGACAGCATGATGAGAAAGG - Intronic
1179311082 21:40196666-40196688 ATGAAACAGAAGAAAGAGAGGGG - Intronic
1180663736 22:17492613-17492635 ACAAAACAGCAGTAAGAGACTGG - Intronic
1182948966 22:34353298-34353320 AGGAAACAGCTGGATGAGATGGG - Intergenic
1183781649 22:40002762-40002784 ATGAGAAAGCACTTTGAGAAGGG + Intronic
1184680092 22:46067374-46067396 ATGAAACAGGCCTATGAAAATGG + Intronic
1184931851 22:47687240-47687262 ATGTTACAGGAGTGTGAGAATGG - Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949315810 3:2753533-2753555 AGGATACAGCAGTGGGAGAAGGG + Intronic
952244750 3:31575038-31575060 ATGAAACAGACTTATGATAAAGG - Intronic
952706952 3:36388327-36388349 ATGAAAAAACAGTATTAAAATGG - Intronic
952776049 3:37047693-37047715 ATACAACAGAAGTATAAGAATGG - Intronic
954100850 3:48371608-48371630 ATGATACAGTAGTAAGAGAGAGG - Intergenic
954928224 3:54256266-54256288 ATTAATCAGCAGTCAGAGAAAGG - Intronic
954971237 3:54653284-54653306 ATGAAACAGCAGTGAGAAATAGG - Intronic
955307425 3:57848322-57848344 AAGAAACAGGAGGAGGAGAAGGG - Intronic
957814802 3:85282652-85282674 TTGCAACAGCAATATGTGAAAGG - Intronic
958488526 3:94743306-94743328 ATGAAAGAACAGTATCAGCAGGG + Intergenic
958740546 3:98065148-98065170 CTGAAAAAGAAGTCTGAGAAGGG + Intergenic
958743551 3:98105424-98105446 CTGAAAAAGAAGTCTGAGAAGGG + Intergenic
958768826 3:98402366-98402388 AGGAAGCTGCAGTATGGGAAAGG - Intergenic
959667599 3:108939172-108939194 ATGAAACACTTGTAGGAGAAAGG - Intronic
959937964 3:112049320-112049342 ATGAAACACAAAAATGAGAAAGG - Intronic
960174157 3:114497392-114497414 TTGAAAGAGTAGTATGAGATTGG - Intronic
960174164 3:114497519-114497541 ATGAAAGAGCAGAAAGAAAAGGG - Intronic
960666403 3:120113082-120113104 TTGAAACAGCCTTATGAGAAAGG + Intergenic
961479741 3:127172070-127172092 ATGAAGCAGGACCATGAGAAAGG + Intergenic
962494707 3:135927334-135927356 ATGAAACAGCATTAGGAGACTGG + Intergenic
962507272 3:136060475-136060497 ATGAGACAGCACTAGGAGGATGG - Intronic
962649881 3:137477804-137477826 ATGAAGCAGCAATATTAGCAGGG + Intergenic
962700553 3:137995262-137995284 ATGAAACAGTAGTAAGAGAATGG - Intergenic
963835075 3:150050035-150050057 ATGAGACAGCACTAAGGGAATGG + Intronic
964244963 3:154641241-154641263 ATTAAAAAACAATATGAGAAGGG + Intergenic
964727847 3:159833380-159833402 CAGAGACGGCAGTATGAGAAAGG - Intronic
964892710 3:161556115-161556137 ATTGATTAGCAGTATGAGAAGGG - Intergenic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965021179 3:163233685-163233707 ATGAAACAGTAATACAAGAATGG + Intergenic
965229867 3:166036677-166036699 ATTAAACAGCAATATAATAATGG - Intergenic
965391406 3:168109031-168109053 CTGAACCAACAGTATAAGAAGGG - Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
967023928 3:185547360-185547382 ATAAAAAAGCAGTATGAGTCAGG - Intronic
967360967 3:188631395-188631417 ATGAATCTGCAGTAAGAGTAAGG - Intronic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969915564 4:10487868-10487890 AAGAAACAGAAGTATGGGTATGG - Exonic
971061463 4:22976687-22976709 TTAAAACAACATTATGAGAAAGG - Intergenic
971881776 4:32383990-32384012 AAGAAACAGCAGAATGTGTAGGG + Intergenic
972081466 4:35156023-35156045 ATGAAAGAGGAGTGAGAGAAAGG + Intergenic
972841833 4:42939936-42939958 TTGAGACAGAAGTATTAGAAGGG + Intronic
972847049 4:43003318-43003340 AAAAAACAGAAGTGTGAGAATGG + Intronic
972973585 4:44606670-44606692 ATGAGACATCAGTTTGAGAGAGG + Intergenic
973278838 4:48338542-48338564 ATGAAACAGGATTAAGAGGATGG + Intergenic
973573706 4:52265234-52265256 CTGGAACAGCAGGATGTGAAGGG + Intergenic
974148354 4:57973710-57973732 AGGAAACATCAGGATAAGAATGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974492527 4:62585539-62585561 ATGTAATAGTAGTATGAGAGGGG + Intergenic
974573589 4:63687957-63687979 ATGAAACAGCACTAAGGGGATGG - Intergenic
974665247 4:64953365-64953387 ATGAGACAGCGTAATGAGAAGGG + Intergenic
975937595 4:79600476-79600498 GTGAAGCAGCAGGATCAGAATGG - Intergenic
976834253 4:89352308-89352330 AAGAAACAGTACTATCAGAAGGG - Intergenic
977650972 4:99469154-99469176 ATTTATCAGCAGCATGAGAATGG - Intergenic
977691013 4:99910987-99911009 ATGAAAGAGCAACATGAGAGTGG - Intronic
978492862 4:109327473-109327495 GTGGAACAGGAGTTTGAGAATGG + Intergenic
978643474 4:110899526-110899548 AAGAAAAAGCAGTAAGAGATAGG - Intergenic
978832820 4:113110048-113110070 ATTTATTAGCAGTATGAGAACGG - Intronic
979507714 4:121516595-121516617 ATTAAAAAGCAGTAGGAAAATGG + Intergenic
979852598 4:125592145-125592167 CTGAAACAGCAGTATCAGTTGGG - Intergenic
980040360 4:127932521-127932543 ATAAAACAGCCATATGATAAAGG + Intronic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981170044 4:141612269-141612291 ATGAAATAGCAATAATAGAATGG + Intergenic
981210176 4:142094218-142094240 AGGAAACAGGAGTATGAGAAGGG + Intronic
981241700 4:142484470-142484492 ATGAAACACTAGAATTAGAAGGG + Intronic
981832462 4:149018097-149018119 CTTCAACAGCAGTATGAAAATGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982796175 4:159647793-159647815 ATAAAACAGTAGGAGGAGAAAGG - Intergenic
982816430 4:159891222-159891244 ATGAAACTGGAGTGTGATAACGG + Intergenic
982868039 4:160543011-160543033 ATCAATCAGCAGTGTGAAAACGG - Intergenic
983320261 4:166188015-166188037 ATAAAACCTCAGTATGGGAAAGG + Intergenic
983812388 4:172078462-172078484 ATTTAACAGCAGTGTGAAAATGG + Intronic
984488165 4:180398956-180398978 ATAAAAAAGCAGTAGGAAAATGG - Intergenic
985559350 5:574712-574734 GTGAAACAACATTATGGGAAGGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987720826 5:21630114-21630136 CTGATACAGCAGGAAGAGAAAGG + Intergenic
987847610 5:23306431-23306453 TTGAGACAACAGTATGGGAAGGG + Intergenic
988006121 5:25413396-25413418 ATGAAACATCACAGTGAGAAGGG + Intergenic
988100175 5:26666303-26666325 ATGAACCAGCTGTGTGATAAAGG - Intergenic
988291102 5:29288070-29288092 CTTTATCAGCAGTATGAGAACGG - Intergenic
988713522 5:33802270-33802292 ATCAAACAGCATTATCTGAAAGG + Intronic
988722884 5:33896070-33896092 ATATAACACCAGTATGATAATGG - Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
990408875 5:55520540-55520562 ATTTCACAGCACTATGAGAAAGG + Intronic
990452191 5:55945312-55945334 ATGAAACAGAAGTGAGAGTATGG + Intronic
991096505 5:62745372-62745394 ATATAACAACAGTCTGAGAAGGG - Intergenic
992122945 5:73613103-73613125 GTCAAACTGCAGTATGTGAAGGG + Intergenic
993249633 5:85503120-85503142 AAGAAAGAGATGTATGAGAAAGG - Intergenic
994293962 5:98066315-98066337 AGGAAACAAGAGTCTGAGAAGGG - Intergenic
994656071 5:102594253-102594275 CTTTAACAGCAGTATGAAAATGG - Intergenic
994771597 5:103988613-103988635 ATGAGACAGCACTAGGGGAATGG + Intergenic
995077409 5:108002561-108002583 ATGAAAGACCTGAATGAGAAAGG + Intronic
995127339 5:108591394-108591416 TGGAAACAACAATATGAGAAAGG - Intergenic
995721211 5:115135551-115135573 ATAAAACAGGTGGATGAGAATGG - Intronic
996324353 5:122255858-122255880 ATGAGACAGCACTAGGGGAATGG + Intergenic
996334371 5:122366956-122366978 GAGAAACAGCAGTAAGAAAATGG + Intronic
996715925 5:126588015-126588037 AAGCACCAGAAGTATGAGAAAGG + Intronic
997580844 5:135015914-135015936 ATGAAACTAAAGTATCAGAAGGG + Intergenic
997705886 5:135952170-135952192 CTGAAACAGGACTAAGAGAAGGG - Intronic
999329380 5:150662309-150662331 ATGGAACAGGAGGAAGAGAAGGG + Intronic
999372840 5:151066556-151066578 ATGAAAGATCAGAGTGAGAAAGG + Intronic
1000252033 5:159504972-159504994 ATGAAACCCCAGTATCACAAGGG + Intergenic
1000276897 5:159745794-159745816 GAGAGACAGCAGTGTGAGAAGGG + Intergenic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1001763895 5:174229767-174229789 TCTAAACAGCAGTATGAGGAAGG - Intronic
1002824344 6:759513-759535 ATTGAAGAGCAGTAAGAGAAAGG - Intergenic
1003233003 6:4271784-4271806 ATGGAACAGCTGGATGAGAGTGG - Intergenic
1008054940 6:46936428-46936450 ATGTGAAAGCATTATGAGAAAGG + Intronic
1008067423 6:47063959-47063981 ATGAAACAGCACTAGGGGGATGG + Intergenic
1008248813 6:49211893-49211915 GTGAAACACCAGTATGTGAGAGG + Intergenic
1010022538 6:71177468-71177490 ATAAAACATCAGGATGAGGATGG + Intergenic
1010301587 6:74266636-74266658 ATGAAACAAGAGCATGAGAAAGG + Intergenic
1010575892 6:77530624-77530646 TTGACACAGCAGTGTGGGAAGGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011924175 6:92621823-92621845 ATGAGACAGAAGAATTAGAAGGG + Intergenic
1012817392 6:104041345-104041367 ATGAGATAGCAGTAGGAGGATGG + Intergenic
1014346785 6:120280390-120280412 ATGAAACAGGACTATGTGAGAGG + Intergenic
1014821691 6:125995617-125995639 ATGAAATAGCTGTATTATAAGGG + Intronic
1014883368 6:126749435-126749457 ATCAAAGAGGAGTATGAGCAAGG + Intergenic
1014916427 6:127155075-127155097 ATAAAACAGGAGAATGGGAAAGG - Intronic
1015406108 6:132838133-132838155 AAGAAACAGCAGGATGATATAGG - Intergenic
1016402123 6:143692332-143692354 ATGAAAGAGCCGGGTGAGAATGG + Intronic
1016779725 6:147944235-147944257 ATGTATCAGCAGCATGAAAAAGG - Intergenic
1018267802 6:162043768-162043790 AGGAAGCAGCAGGAAGAGAAAGG + Intronic
1018515930 6:164580250-164580272 ATAAAATAGCTGTATGAAAATGG + Intergenic
1021852023 7:24817653-24817675 ATGGAACAGGAGTAGGAGAGAGG + Intronic
1022678554 7:32523048-32523070 ATGAATCAGCAGCATGAAAATGG + Intronic
1022991153 7:35708575-35708597 ATGAAACAGCAATCTAAAAATGG - Intergenic
1024519956 7:50296937-50296959 AGGAGACAGCAGTAAGTGAAAGG + Intergenic
1026204156 7:68241018-68241040 AGGAAACAGCAGTAGAAGACTGG + Intergenic
1026497730 7:70918350-70918372 ATGAAACACCATTATCAGAAAGG - Intergenic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1030553185 7:110990518-110990540 ATGAAAAAGAAGTATGGCAAGGG - Intronic
1031709258 7:125023730-125023752 CTTAACCAGCAGTATGAAAATGG + Intergenic
1032532474 7:132633608-132633630 ATGACACAGTAGACTGAGAAAGG - Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033164048 7:139023463-139023485 ATGCAAGAGCAGTGGGAGAAGGG - Intergenic
1033928146 7:146489391-146489413 CTAAAAGAGCAGTAAGAGAAAGG - Intronic
1034124649 7:148660477-148660499 ATGGAACAGCTGTAGTAGAAAGG - Intergenic
1036026733 8:4917237-4917259 ATGAGACAGCAGTAGGGGGATGG + Intronic
1036537309 8:9662786-9662808 ATGAAAGAGCAGTATTTGAGAGG + Intronic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037868030 8:22463527-22463549 ATTAACCAGCATTATCAGAATGG + Intronic
1039151427 8:34510955-34510977 ATGACACAGCACAATGAGACTGG + Intergenic
1039519851 8:38160954-38160976 ATAAAACAGAAGTATGAAATGGG + Intergenic
1039736236 8:40335797-40335819 TTGACACAGCCGTATGAGAGGGG - Intergenic
1039822583 8:41146857-41146879 ATGAAACTGCAGTTTGTGGAGGG + Intergenic
1040909633 8:52504762-52504784 ATGTAACATCATTATGACAATGG - Intergenic
1041579339 8:59439354-59439376 ATGAGACAGCACTAGGGGAATGG - Intergenic
1041768659 8:61448778-61448800 ATGAAAAAGTAGTTTTAGAAAGG - Intronic
1042495311 8:69449084-69449106 ATAAAATATCAGAATGAGAATGG + Intergenic
1042580780 8:70276910-70276932 ATGAGACAGCAGAATGAAAGTGG - Intronic
1045624810 8:104031748-104031770 AAGAAACACCAGTCTGAGACAGG + Intronic
1046504418 8:115118580-115118602 TTGAATGAACAGTATGAGAAAGG + Intergenic
1046786330 8:118271103-118271125 ATCAATTAGCAGCATGAGAATGG - Intronic
1047109121 8:121768941-121768963 GTGAAACAGAAGTAGGAGCATGG + Intergenic
1047689329 8:127335331-127335353 ATGAGTCAGCAGTCTGAGCATGG + Intergenic
1049943923 9:576188-576210 ATGAATCAGAAGTATGTGGAGGG - Intronic
1050287058 9:4114400-4114422 ATGAAACAGGGGTTTGGGAAAGG + Intronic
1050623258 9:7476734-7476756 ATTAAACAGGTGTTTGAGAAAGG + Intergenic
1050741996 9:8831395-8831417 ATGAAACTGCATTAGGAGACCGG + Intronic
1051516713 9:17937922-17937944 AAGTAACAGAAGTATGAGGAGGG + Intergenic
1052755911 9:32540532-32540554 ATGTAAAAGAAGTATGACAAGGG + Exonic
1052766543 9:32647103-32647125 ATAAAACATCAGAATGAGAAAGG - Intergenic
1054994209 9:71366262-71366284 AGGAAACAGTAGTAGGATAAAGG - Intronic
1055006035 9:71507857-71507879 CTTTAACAGCAGCATGAGAATGG + Intergenic
1055858607 9:80722616-80722638 ATGTATTAGCAGCATGAGAATGG - Intergenic
1055874117 9:80922364-80922386 ATGAAGGAGCAGTAAAAGAAGGG + Intergenic
1056636912 9:88338787-88338809 ATGAAAAAGCAGCATGGGACTGG - Intergenic
1057540297 9:95961604-95961626 ATGAAACTTCTGTATGACAAAGG + Intronic
1059790776 9:117639739-117639761 ATGAAACCGGAGACTGAGAAGGG + Intergenic
1059978959 9:119748088-119748110 ATGACAAAGCAGTCTGGGAAAGG - Intergenic
1060134978 9:121144817-121144839 CTGGGACAGAAGTATGAGAAAGG - Intronic
1060315040 9:122501826-122501848 AGGAAACAGCAATAGGAGAGTGG + Intergenic
1060725261 9:126002100-126002122 GAGAGACAGCAGTTTGAGAAGGG - Intergenic
1060987387 9:127827598-127827620 ATGAAACAGCAGCAGCAGAAGGG + Intronic
1186141587 X:6580119-6580141 ATGAAACAGCACTAGGGGGATGG + Intergenic
1186145001 X:6615879-6615901 ATGAGACAGCACTAGGAGGATGG - Intergenic
1186317139 X:8383340-8383362 ATAAAACAACAGTATTTGAAGGG - Intergenic
1186800493 X:13087783-13087805 AGGAAGCATCAGTATGAGATAGG + Intergenic
1187030514 X:15483276-15483298 ATGAAACACCAGGTTGAGATAGG - Intronic
1188072349 X:25732082-25732104 ATGGAACCCCAGTATGGGAAAGG - Intergenic
1188394897 X:29669925-29669947 TTGAAAGATCAGTATGAGCATGG - Intronic
1188698492 X:33228513-33228535 ATAAAACCTCAGTATGAAAACGG + Intronic
1188730894 X:33645456-33645478 AAGAAAAAGGAGGATGAGAAAGG + Intergenic
1189003657 X:36972351-36972373 AGGAGAAACCAGTATGAGAATGG - Intergenic
1189533711 X:41913990-41914012 ATGAAATAGCAGTAGTATAATGG + Intronic
1189895428 X:45650603-45650625 ATGAAACAGCATTAAAAAAATGG + Intergenic
1189945150 X:46170460-46170482 ATGTATCAGCAGCATGAAAACGG - Intergenic
1190648096 X:52541951-52541973 ATGAAACAGAAGGATAGGAAGGG - Intergenic
1191121075 X:56905949-56905971 AGGAAGCATCAGTATGATAAGGG - Intergenic
1194150687 X:90322625-90322647 ATGAGACAGCACTAGGAGGATGG + Intergenic
1194675859 X:96793060-96793082 ATGTAACAGCAGCATTATAAAGG - Intronic
1195436056 X:104844438-104844460 ATGAAACATCAGTATATTAAAGG - Intronic
1195644958 X:107220433-107220455 ATCAAACATCAGGATGAAAAGGG - Intronic
1198151776 X:133917776-133917798 ATGAACCAGCAGTATTTGAGAGG - Intronic
1198888299 X:141363074-141363096 ATTTATCAGCAGTATGAAAATGG - Intergenic
1199324595 X:146482702-146482724 CTTATACAGCAGCATGAGAATGG - Intergenic
1199929613 X:152505461-152505483 ATTTATCAGCAGTGTGAGAATGG - Intergenic
1200497054 Y:3899386-3899408 ATGAGACAGCACTAGGAGGATGG + Intergenic
1201461945 Y:14235417-14235439 CTGTAACAGCAGTGTGAAAACGG + Intergenic
1202329095 Y:23726805-23726827 AATTAGCAGCAGTATGAGAATGG - Intergenic
1202541676 Y:25943249-25943271 AATTAGCAGCAGTATGAGAATGG + Intergenic