ID: 1027824977

View in Genome Browser
Species Human (GRCh38)
Location 7:83100607-83100629
Sequence GAACACGTGCTCACATAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027824972_1027824977 22 Left 1027824972 7:83100562-83100584 CCAAATACCGCATGTTCTCACTT 0: 287
1: 3819
2: 13829
3: 24210
4: 13072
Right 1027824977 7:83100607-83100629 GAACACGTGCTCACATAGAGAGG No data
1027824973_1027824977 15 Left 1027824973 7:83100569-83100591 CCGCATGTTCTCACTTATAAGTG 0: 2009
1: 7339
2: 15066
3: 14798
4: 4805
Right 1027824977 7:83100607-83100629 GAACACGTGCTCACATAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027824977 Original CRISPR GAACACGTGCTCACATAGAG AGG Intronic
No off target data available for this crispr