ID: 1027826101

View in Genome Browser
Species Human (GRCh38)
Location 7:83118544-83118566
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027826092_1027826101 22 Left 1027826092 7:83118499-83118521 CCCAGCAGTGAGCATAGAGAGAG No data
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826093_1027826101 21 Left 1027826093 7:83118500-83118522 CCAGCAGTGAGCATAGAGAGAGA No data
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826089_1027826101 28 Left 1027826089 7:83118493-83118515 CCATCCCCCAGCAGTGAGCATAG 0: 1
1: 0
2: 4
3: 37
4: 291
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826099_1027826101 -9 Left 1027826099 7:83118530-83118552 CCCTTGGAAGAGGGAGGGAGAGC 0: 1
1: 0
2: 2
3: 30
4: 478
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826100_1027826101 -10 Left 1027826100 7:83118531-83118553 CCTTGGAAGAGGGAGGGAGAGCA 0: 1
1: 0
2: 4
3: 71
4: 582
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826091_1027826101 23 Left 1027826091 7:83118498-83118520 CCCCAGCAGTGAGCATAGAGAGA 0: 1
1: 1
2: 1
3: 25
4: 227
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826087_1027826101 30 Left 1027826087 7:83118491-83118513 CCCCATCCCCCAGCAGTGAGCAT 0: 1
1: 1
2: 6
3: 50
4: 336
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826090_1027826101 24 Left 1027826090 7:83118497-83118519 CCCCCAGCAGTGAGCATAGAGAG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data
1027826088_1027826101 29 Left 1027826088 7:83118492-83118514 CCCATCCCCCAGCAGTGAGCATA 0: 1
1: 0
2: 6
3: 35
4: 234
Right 1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type