ID: 1027829312

View in Genome Browser
Species Human (GRCh38)
Location 7:83157010-83157032
Sequence TATAAACTTTTTAGCATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027829312_1027829315 14 Left 1027829312 7:83157010-83157032 CCAGGAATGCTAAAAAGTTTATA 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG No data
1027829312_1027829314 -2 Left 1027829312 7:83157010-83157032 CCAGGAATGCTAAAAAGTTTATA 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1027829314 7:83157031-83157053 TAATCTATTTAATTTTACTTGGG 0: 1
1: 1
2: 9
3: 84
4: 823
1027829312_1027829316 26 Left 1027829312 7:83157010-83157032 CCAGGAATGCTAAAAAGTTTATA 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1027829316 7:83157059-83157081 AGTGATCCAGGTCACTAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 67
1027829312_1027829313 -3 Left 1027829312 7:83157010-83157032 CCAGGAATGCTAAAAAGTTTATA 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1027829313 7:83157030-83157052 ATAATCTATTTAATTTTACTTGG 0: 1
1: 0
2: 6
3: 80
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027829312 Original CRISPR TATAAACTTTTTAGCATTCC TGG (reversed) Intronic
905597718 1:39222772-39222794 TATATCCTTTTTAGATTTCCAGG + Intronic
906091573 1:43184102-43184124 TATAAACATTATAGTATTACTGG + Intronic
907092303 1:51737295-51737317 TATAACCATTTTAGCATGCAAGG - Intronic
909551962 1:76907899-76907921 ATTAATATTTTTAGCATTCCTGG - Intronic
915550777 1:156632499-156632521 CATTAACTCTCTAGCATTCCTGG + Intergenic
916188797 1:162159180-162159202 GTTTAACTTTTTAGCTTTCCTGG + Intronic
916346206 1:163794235-163794257 TATAGACTTCTTAGGATTCTTGG - Intergenic
916750395 1:167718377-167718399 TATAAACTTCTTAGGTGTCCAGG - Intergenic
918164637 1:181933176-181933198 TAGAAATTCTTTAGTATTCCTGG - Intergenic
918333922 1:183488656-183488678 TATAAACATTTTACTTTTCCTGG - Intronic
918673781 1:187256056-187256078 TATTCACTTTTTAGCACTTCAGG - Intergenic
920803711 1:209212755-209212777 TATAAAATTTCTTGAATTCCAGG - Intergenic
921157274 1:212448527-212448549 TATTAACACTTTAGCATACCAGG + Intergenic
921881767 1:220262918-220262940 TATAAACTTTTGTGCATTGTTGG - Intronic
923768136 1:236912011-236912033 TTTCAACTTTTTAGCATTGTAGG + Intergenic
923894065 1:238249480-238249502 CATACACTTTTTAGCAGTCAAGG - Intergenic
1064422399 10:15201961-15201983 TATAAAATGGTTAGCATTCTGGG + Intergenic
1064509178 10:16071169-16071191 TAGAAAATATTCAGCATTCCAGG + Intergenic
1064519688 10:16188091-16188113 CAAAAACGTTATAGCATTCCTGG - Intergenic
1068479631 10:57574159-57574181 GATAAACTATTTAGCATTTTAGG - Intergenic
1068588614 10:58829719-58829741 TAAAATCATTTTAGCATTACAGG - Exonic
1068828281 10:61464348-61464370 TATTAGCATTTTAGTATTCCTGG - Intergenic
1068901676 10:62276830-62276852 TATAACTTTTATAGCATTGCTGG - Intergenic
1068998203 10:63232346-63232368 TAAAAAATTTTTAACATTCATGG - Intronic
1069476864 10:68742275-68742297 TATGAAATTTTTAACATTCTGGG + Intronic
1069890753 10:71651034-71651056 TATAAAGTTTATAGTCTTCCAGG + Intronic
1069944499 10:71976479-71976501 TGTGAACTTATCAGCATTCCTGG - Intronic
1070368867 10:75762729-75762751 GATAAAGTTTTTAGAATCCCTGG + Intronic
1071079594 10:81794997-81795019 TATATCCTTTATAACATTCCTGG - Intergenic
1071186088 10:83047237-83047259 TATAATCTTTTAAGCATGCAAGG - Intergenic
1072678583 10:97488375-97488397 TATAACATCTTTAGAATTCCAGG + Intronic
1077616077 11:3675012-3675034 TAAAATGTTTATAGCATTCCTGG - Exonic
1077977928 11:7268840-7268862 TAGAACCTTTTCAACATTCCAGG + Intronic
1078268363 11:9772054-9772076 AAAAAACCTTTTATCATTCCAGG + Intergenic
1079743159 11:24089808-24089830 TATAAACATTAAAGAATTCCTGG + Intergenic
1081152562 11:39650051-39650073 TATAAACATATTAGCATTTGTGG + Intergenic
1086461965 11:87014863-87014885 TATAACCTGTTTATCATTCTAGG - Intergenic
1086768581 11:90731059-90731081 TATTAACTTTATAGGTTTCCTGG + Intergenic
1088104221 11:106187566-106187588 TATAAACTTCTTTGCATAGCTGG - Intergenic
1088262060 11:107953608-107953630 TATAAACGTTTTAGTATTCAAGG - Intronic
1088612063 11:111587397-111587419 TATAAGCTTATAAGCATGCCCGG + Intergenic
1088661806 11:112054666-112054688 TATAAACTGTATAGTTTTCCAGG + Intronic
1089357466 11:117863276-117863298 TTGAAACATTTTTGCATTCCAGG - Intronic
1093774757 12:23060485-23060507 TAAAAACTTTATAGCATGTCAGG + Intergenic
1096797894 12:54090030-54090052 CATAATGTTTTTAGCATACCAGG - Intergenic
1097217989 12:57429433-57429455 TTTAAACTTTTTGTCTTTCCCGG + Intronic
1098423331 12:70328583-70328605 TATAAATTTTTTAATAATCCAGG - Intronic
1099083764 12:78219599-78219621 TATAAAATTTTGAGCTTTTCTGG - Intergenic
1099644392 12:85333371-85333393 TTTCAACTTTTTAGTATTACTGG + Intergenic
1099714761 12:86277075-86277097 TATATCCTCTTTAGCATTTCTGG + Intronic
1100005720 12:89892699-89892721 TACCAACCTTATAGCATTCCTGG - Intergenic
1100802352 12:98246109-98246131 TATAAACTTTTCAGCTCTGCAGG - Intergenic
1104139058 12:125969114-125969136 TATCAAGGTATTAGCATTCCAGG - Intergenic
1105293122 13:19066272-19066294 TAAAAACTTTTTTGCATTAAAGG + Intergenic
1105380436 13:19882191-19882213 TAAAAACTTTTGTGCATCCCAGG + Intergenic
1107726146 13:43301502-43301524 TATAATATTGTTTGCATTCCCGG + Intronic
1108589391 13:51898786-51898808 TATTACCTTTTTAGCATGCTGGG - Intergenic
1110639267 13:77803095-77803117 TCTAAACATTGTAGCACTCCAGG - Intergenic
1111424274 13:88058717-88058739 TATAAACGTTTTATGATTTCGGG + Intergenic
1111555992 13:89882890-89882912 AATAAACTCTTTACCCTTCCTGG + Intergenic
1114166837 14:20227272-20227294 TACAAACGTCATAGCATTCCTGG - Intergenic
1115140205 14:30162021-30162043 TATAAACTTCTCAGCTTTGCAGG - Intronic
1118297852 14:64586616-64586638 GATTAACTTTTTACCATTCTAGG + Intronic
1118355762 14:65012295-65012317 TATAAACTGTTTGTCTTTCCAGG + Exonic
1120292770 14:82597676-82597698 TATAAATCTTTGAACATTCCTGG + Intergenic
1121003965 14:90475330-90475352 CATGAACATTTTAGCTTTCCAGG - Intergenic
1125230444 15:37449124-37449146 TAGAAATTTTTAAGTATTCCAGG - Intergenic
1125864461 15:43032353-43032375 TATAAAATTTTTAGCACTAAAGG + Intronic
1126458484 15:48890317-48890339 TTTAGACTTTTTAGGCTTCCTGG - Intronic
1127084260 15:55410155-55410177 TAAAAATTTTTTAGATTTCCAGG - Intronic
1127345425 15:58092255-58092277 GATAAAATTTTTATTATTCCTGG - Intronic
1128661436 15:69504063-69504085 TAGAATCTTTACAGCATTCCTGG - Intergenic
1133419703 16:5635911-5635933 TCAAAACTATTTAACATTCCAGG + Intergenic
1134144763 16:11751633-11751655 TATAAAATATTTACCATTCTAGG - Intronic
1135296348 16:21282981-21283003 AATAAACTTTTTAGTAATGCAGG + Intronic
1137876675 16:52003453-52003475 TATAAATTTTTAAGTATTGCTGG - Intergenic
1139111716 16:63899881-63899903 TAGCAACTTTTTTGCATTTCAGG + Intergenic
1140193792 16:72839875-72839897 TGAAAGCTTTTTAACATTCCAGG + Intronic
1140625558 16:76789858-76789880 TATAAACTTTTGGGGACTCCAGG - Intergenic
1140839129 16:78822558-78822580 TATAAAATATTTAGAATTCTAGG - Intronic
1141026119 16:80550275-80550297 TTTAAAATTTTTTCCATTCCTGG + Intronic
1142208825 16:88797583-88797605 GAAAAACTTTTTAGCATACTTGG + Intergenic
1144077565 17:11733048-11733070 TTTAAACATTTTAACATTTCTGG - Intronic
1147799846 17:43076909-43076931 TATATATTTTTTATCATTCAGGG - Intronic
1148042133 17:44716350-44716372 TATAAGCTTGTCAGCATTCTGGG + Intronic
1148171520 17:45524829-45524851 TATAAAGTTTTTAAAATTCATGG + Intergenic
1148364503 17:47043720-47043742 TATAAAGTTTTTAAAATTCATGG - Intronic
1148763112 17:50019061-50019083 TATAAAATTCTAAGTATTCCAGG + Intergenic
1152323024 17:79619148-79619170 TGTAAGCTCTTTAGCACTCCAGG + Intergenic
1158044641 18:53141430-53141452 TTTCAACTTTTTTGCCTTCCTGG - Intronic
1158767185 18:60466341-60466363 TAACAAATTTTTATCATTCCTGG + Intergenic
1158869844 18:61675477-61675499 TATAAACTTTTTGTGTTTCCTGG - Intergenic
1158930684 18:62323304-62323326 TATAACCTGTTTTGAATTCCTGG - Intergenic
1159469306 18:68830106-68830128 TTTTAACATTTTAGCATTTCCGG + Intronic
1159934030 18:74347013-74347035 TATAAACTTTTTCCAATTACAGG - Intronic
1161551386 19:4914746-4914768 CATAATCTTTTCAGCATCCCTGG + Intronic
1164975326 19:32568629-32568651 AATAAATTTTTTTTCATTCCTGG - Intergenic
1166199662 19:41228634-41228656 TATGTACTTATGAGCATTCCTGG - Intronic
1167980831 19:53273413-53273435 TGTTAACTTTTAAGCATTCTTGG - Intergenic
1168198891 19:54798691-54798713 CAAAAGCTTTTTAACATTCCTGG - Intronic
926505307 2:13706864-13706886 TCAACACTTTTTAGCATTTCAGG + Intergenic
926831355 2:16965716-16965738 TATAAACTTTATTTCATTCATGG - Intergenic
927302519 2:21532018-21532040 TATAAACTTTTTAGTTTTTATGG + Intergenic
928773357 2:34729067-34729089 TATAAGCTTTTTACTAATCCAGG - Intergenic
930865363 2:56117555-56117577 TGTAAATTGTTTAGGATTCCTGG - Intergenic
932146707 2:69326562-69326584 TGAAGACTTTGTAGCATTCCTGG - Intronic
933449226 2:82425064-82425086 TATTAACTTTCTATCATTGCTGG - Intergenic
933531975 2:83522115-83522137 GATAAACTTTTTAGAATCCTTGG - Intergenic
938245704 2:129776285-129776307 TATAAACTTTTAAGCACTGCTGG + Intergenic
942166970 2:173251205-173251227 AATAAACTTTTTAAGATTCAAGG - Intronic
942964291 2:181872067-181872089 TATAAATTTTTTAGAATGCCTGG - Intergenic
942970539 2:181952955-181952977 TAGAAACTCTCTGGCATTCCTGG + Intergenic
943448261 2:188017063-188017085 TTTAAACTTATTAGCAATTCTGG + Intergenic
944092262 2:195925041-195925063 TTTAAACTTTTTCTCATTCTTGG - Intronic
944871806 2:203919450-203919472 TATAAACAGTATAGCATGCCAGG - Intergenic
946276396 2:218634908-218634930 TATAAAGTTCTTACAATTCCTGG + Intronic
947701687 2:232239792-232239814 TAGAAACTTTTGGGCTTTCCTGG - Intronic
948077236 2:235174423-235174445 TTTAAACTCTTCAGGATTCCAGG + Intergenic
948215467 2:236226164-236226186 TATTAACTTTTTATCCTTCAAGG + Intronic
1169686768 20:8283306-8283328 TTTATACTTTTTTGCATTCTGGG - Intronic
1169882793 20:10365671-10365693 TCTAAACCTTTTGGAATTCCTGG - Intergenic
1169959040 20:11138383-11138405 TACAATCTTTTTAGGATTCAAGG + Intergenic
1171849733 20:30299856-30299878 CATAATGTTTTTAGCATACCAGG - Intergenic
1172378420 20:34466235-34466257 TTGAACCTTTTTTGCATTCCAGG + Intronic
1175274559 20:57759283-57759305 CATAAACTTTCAAGCACTCCTGG + Intergenic
1177140296 21:17351506-17351528 TATAAACTTTTTAATAGTGCTGG + Intergenic
1178108208 21:29344999-29345021 TATAAACAGTTTAGCATTAAGGG + Exonic
1178542522 21:33465959-33465981 TATAACCTTTTTAAAACTCCTGG + Intronic
1178579279 21:33824083-33824105 TAGAAAGTTTTTAGAATTTCTGG + Intronic
1179381712 21:40905444-40905466 GATAAAATTTTTAGCATTACTGG - Intergenic
1180128679 21:45810166-45810188 TATAACCAATTTTGCATTCCTGG + Intronic
1181878326 22:25957343-25957365 TATAATCTTTTCAGTATTTCAGG - Intronic
1182747848 22:32619313-32619335 TATGAACTTTATAGGATTTCAGG - Intronic
1182800041 22:33024676-33024698 TATAATCTTTATTGTATTCCAGG - Intronic
1184420399 22:44379108-44379130 TAAAAAATGTTTAGCATTCTAGG + Intergenic
949391604 3:3568657-3568679 TAAAAAATTTGTAGCATTCCTGG + Intergenic
950238567 3:11346534-11346556 TTTAAACTGTGTAGCATTCCAGG + Intronic
950513056 3:13444892-13444914 GATAAACCATTTTGCATTCCTGG - Intergenic
951807061 3:26657317-26657339 TTTGAAATTCTTAGCATTCCAGG + Intronic
955580943 3:60421383-60421405 GATAAACATTTTAGCATACTTGG + Intronic
956203752 3:66734921-66734943 CAAAGGCTTTTTAGCATTCCAGG + Intergenic
957803348 3:85115054-85115076 TTTGAAATTTTAAGCATTCCAGG - Intronic
958499322 3:94885775-94885797 AGTAAAATCTTTAGCATTCCTGG + Intergenic
958843090 3:99232555-99232577 CAAAAACATTTGAGCATTCCTGG + Intergenic
959233050 3:103681892-103681914 ATTAGACTTTTTAGTATTCCTGG + Intergenic
962173711 3:133129694-133129716 TATAAAATACTTAGCATGCCTGG - Intronic
964298808 3:155264207-155264229 TTTAAACTTCTTTGGATTCCTGG + Intergenic
965503653 3:169486343-169486365 TGAAAATTTTTTAACATTCCTGG - Intronic
967669232 3:192212645-192212667 TATAAACCTTTTATCCTGCCTGG + Intronic
967745034 3:193045831-193045853 TATAAATATTTTTTCATTCCAGG + Intergenic
968091239 3:195899628-195899650 TTTAAACTTTTTAAAATTCTTGG - Intronic
972256115 4:37357645-37357667 GATAAAATTTTTTGCTTTCCCGG + Intronic
972441172 4:39093585-39093607 AATAATCATTTTAGTATTCCTGG - Intronic
972734290 4:41825727-41825749 TACAAACATTTTAGCATTTTAGG - Intergenic
974341953 4:60625563-60625585 TTTAAACTTTTTTCCATTACTGG + Intergenic
974604572 4:64134538-64134560 TATAAAAATTTTAGCCTTCATGG - Intergenic
975099430 4:70495665-70495687 TCTAAACTCTTTTGCATTACTGG - Intergenic
976923869 4:90472472-90472494 TATAAATTTTTCAGCATAGCAGG + Intronic
979782628 4:124672276-124672298 TATAAACCATTTAGAGTTCCTGG + Exonic
984866647 4:184286241-184286263 TATAATCATGTTAGCATTTCTGG - Intergenic
986492138 5:8304154-8304176 TATAAACTTTTAAATATTCTTGG - Intergenic
986515986 5:8564416-8564438 TAAAAACTGTTTATCATTTCTGG - Intergenic
987483250 5:18486943-18486965 ACTAATCTTTTTAACATTCCCGG - Intergenic
987698390 5:21362019-21362041 TATAAATTTGTTAGCTTACCTGG - Intergenic
988096048 5:26611780-26611802 TAGAATCTTTTTTGCATTTCTGG + Intergenic
989814772 5:45722599-45722621 TATAAACTCTTAAGTATTTCTGG + Intergenic
990394568 5:55363470-55363492 TGTAAACTTTGAAGGATTCCAGG - Intronic
991742038 5:69690354-69690376 TATAAATTTGTTAGCTTACCTGG + Intergenic
991755655 5:69864854-69864876 TATAAATTTGTTAGCTTACCTGG - Intergenic
991793612 5:70270094-70270116 TATAAATTTGTTAGCTTACCTGG + Intergenic
991821428 5:70565658-70565680 TATAAATTTGTTAGCTTACCTGG + Intergenic
991834982 5:70740002-70740024 TATAAATTTGTTAGCTTACCTGG - Intergenic
991885991 5:71269626-71269648 TATAAATTTGTTAGCTTACCTGG + Intergenic
993255383 5:85584428-85584450 TTGAAACTTTTTAGCATACAAGG + Intergenic
994660654 5:102649969-102649991 TATGAATGTTTTAGCATTCTGGG - Intergenic
996534514 5:124563440-124563462 TAGAAACTCTTTAACATTGCCGG + Intergenic
996860434 5:128059572-128059594 TATAAACTTACTAGCCTTCAGGG + Intergenic
996972489 5:129388845-129388867 TATACATTTTTTAATATTCCTGG + Intergenic
998707973 5:144786095-144786117 GATAAACCTTTTAGCCTTTCTGG - Intergenic
1000914271 5:167060997-167061019 TCTAAAATTTTTAGTTTTCCAGG + Intergenic
1001394481 5:171406271-171406293 TGTAAACCCTTTAGCCTTCCTGG + Intronic
1002391579 5:178917241-178917263 TATAATCTTTTTAGCTCTCCAGG + Intronic
1005552443 6:26936362-26936384 TATAAATTTGTTAGCTTACCTGG + Intergenic
1006562513 6:34925871-34925893 TATGAAATTTATAGCATCCCTGG - Intronic
1008600540 6:53089669-53089691 GATAAACTTTTTGTCTTTCCTGG - Intronic
1011535896 6:88375640-88375662 TATTAACAATTTAACATTCCTGG - Intergenic
1012041154 6:94205722-94205744 TATAAACTTTATAAAAATCCAGG - Intergenic
1013253620 6:108360537-108360559 TATTAACATTTTTGCATTCTAGG - Intronic
1015415493 6:132942859-132942881 TATCAACCTTTTATGATTCCTGG - Intergenic
1016734105 6:147457179-147457201 TATGAACATTTTAGCAGTACAGG - Intergenic
1020147385 7:5655058-5655080 TAGATACTTTTTAGCATTCCTGG + Intronic
1020161964 7:5780162-5780184 TAGATAGTTTTTAGCATTCCTGG + Intronic
1022168751 7:27801265-27801287 TTTAAACCATTTAGAATTCCTGG - Intronic
1022798151 7:33749237-33749259 CAAAAACTTTTTTGGATTCCTGG + Intergenic
1024457290 7:49623844-49623866 TATCAACTTTATAGCACTCCAGG + Intergenic
1025984915 7:66441377-66441399 TATGTACATTTTAGCATTACTGG + Intergenic
1027738425 7:81965929-81965951 AATAATCTTTTTACCATTTCCGG + Intronic
1027829312 7:83157010-83157032 TATAAACTTTTTAGCATTCCTGG - Intronic
1028522276 7:91744876-91744898 TATAAACTTCTGAGGATTTCTGG + Intronic
1028740964 7:94274579-94274601 TAAAAACTTTCTAGCAGTCAAGG - Intergenic
1028850888 7:95536174-95536196 GAAAATCGTTTTAGCATTCCAGG + Intronic
1030492716 7:110257961-110257983 TAAATACATTTTAGCTTTCCAGG + Intergenic
1030620115 7:111780041-111780063 TAAAAAGTTTTTAGAATTCCTGG - Intronic
1031567101 7:123313998-123314020 TATTAGCTTTTTGGCATTACAGG + Intergenic
1033382143 7:140832050-140832072 TAGAAATTTTTAAGAATTCCTGG - Intronic
1033895927 7:146070023-146070045 TATAAATTTTTTAATAATCCAGG - Intergenic
1037601516 8:20399869-20399891 TTGAAACTTTTTTGCATCCCAGG - Intergenic
1038417683 8:27409260-27409282 TATAAAGTTTTTTGGAATCCAGG + Intronic
1040861608 8:52005252-52005274 TATAAAATTTTTAGAATTTAGGG - Intergenic
1041398178 8:57413679-57413701 TATAAACTGTTTATCATTTCTGG - Intergenic
1041911174 8:63089448-63089470 TATAAAAATTTTAGAATTCTTGG + Intergenic
1042283028 8:67075704-67075726 TATAAAGTCCTTGGCATTCCTGG - Intronic
1045182205 8:99796552-99796574 TATAAACTTCTTCCCATTCAAGG - Intronic
1048564221 8:135577835-135577857 TATATACTATGTTGCATTCCAGG + Intronic
1048744375 8:137597662-137597684 TATAAGCATTAAAGCATTCCTGG + Intergenic
1050095312 9:2058613-2058635 TAAAAACTTTTTCTCTTTCCTGG + Intronic
1051915495 9:22201697-22201719 TATAAACATTTTTCCATTCCAGG - Intergenic
1052133357 9:24879198-24879220 TATTAACTTTCTCGCATTACTGG - Intergenic
1052145139 9:25039895-25039917 TAAAAACTTTTTTCCATTCTGGG + Intergenic
1052570510 9:30215436-30215458 TGTAAAGACTTTAGCATTCCAGG - Intergenic
1053318871 9:37077980-37078002 TTTAATCTTTTTTACATTCCTGG + Intergenic
1053787505 9:41663148-41663170 CATAATGTTTTTAGCATACCAGG - Intergenic
1054157618 9:61651619-61651641 CATAATGTTTTTAGCATACCAGG + Intergenic
1054175783 9:61874487-61874509 CATAATGTTTTTAGCATACCAGG - Intergenic
1054477392 9:65582624-65582646 CATAATGTTTTTAGCATACCAGG + Intergenic
1054661756 9:67706323-67706345 CATAATGTTTTTAGCATACCAGG + Intergenic
1055216983 9:73876451-73876473 TATACACTTTTTAAATTTCCAGG - Intergenic
1055393616 9:75849866-75849888 TATAAATTCTTTAGTATTTCAGG + Intergenic
1056320163 9:85428348-85428370 TTTAAACTCTTTAGAATCCCAGG - Intergenic
1056912607 9:90716526-90716548 TGTCAACTTTTGAGAATTCCTGG + Intergenic
1057431981 9:95003821-95003843 TTTCAACTTTTTTGTATTCCTGG + Intronic
1059495786 9:114708125-114708147 AATGAGCTTTTTATCATTCCTGG + Intergenic
1060138344 9:121180359-121180381 TGTAAACGTTTTTGCATTACAGG - Exonic
1186120342 X:6354460-6354482 GCTAAACTTTTTCTCATTCCTGG + Intergenic
1187093301 X:16120230-16120252 TTTAAACTATTTGGCATTCAGGG + Intergenic
1187261060 X:17685748-17685770 TATAACCTTTTTGGCGTTCAAGG + Intronic
1191820596 X:65301985-65302007 AAAAAACTTTTTAGCAAACCAGG + Intergenic
1192050663 X:67721288-67721310 TATGAAATTTCTAGTATTCCAGG + Intronic
1192492928 X:71591995-71592017 TAAAACCTTTTTTGCATTTCAGG + Intronic
1193245408 X:79223031-79223053 TATAAAAATTTTAGCAGTACTGG + Intergenic
1201326346 Y:12764145-12764167 TAAAAACTTTTTACAATTTCTGG - Intronic