ID: 1027829315

View in Genome Browser
Species Human (GRCh38)
Location 7:83157047-83157069
Sequence ACTTGGGCTTCTAGTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027829311_1027829315 15 Left 1027829311 7:83157009-83157031 CCCAGGAATGCTAAAAAGTTTAT 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG No data
1027829312_1027829315 14 Left 1027829312 7:83157010-83157032 CCAGGAATGCTAAAAAGTTTATA 0: 1
1: 0
2: 1
3: 12
4: 227
Right 1027829315 7:83157047-83157069 ACTTGGGCTTCTAGTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027829315 Original CRISPR ACTTGGGCTTCTAGTGATCC AGG Intronic
No off target data available for this crispr