ID: 1027830160

View in Genome Browser
Species Human (GRCh38)
Location 7:83166778-83166800
Sequence TTTCCCTTTTCAAAAATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830160_1027830168 23 Left 1027830160 7:83166778-83166800 CCACTTATTTTTGAAAAGGGAAA No data
Right 1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG No data
1027830160_1027830161 7 Left 1027830160 7:83166778-83166800 CCACTTATTTTTGAAAAGGGAAA No data
Right 1027830161 7:83166808-83166830 GTTCCCACTCCTAGCTCCATTGG No data
1027830160_1027830164 15 Left 1027830160 7:83166778-83166800 CCACTTATTTTTGAAAAGGGAAA No data
Right 1027830164 7:83166816-83166838 TCCTAGCTCCATTGGCAATATGG No data
1027830160_1027830166 22 Left 1027830160 7:83166778-83166800 CCACTTATTTTTGAAAAGGGAAA No data
Right 1027830166 7:83166823-83166845 TCCATTGGCAATATGGCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830160 Original CRISPR TTTCCCTTTTCAAAAATAAG TGG (reversed) Intergenic
No off target data available for this crispr