ID: 1027830162

View in Genome Browser
Species Human (GRCh38)
Location 7:83166811-83166833
Sequence TTGCCAATGGAGCTAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830162_1027830171 18 Left 1027830162 7:83166811-83166833 CCCACTCCTAGCTCCATTGGCAA No data
Right 1027830171 7:83166852-83166874 GTAGGACCAACATGTCAGTGAGG No data
1027830162_1027830169 0 Left 1027830162 7:83166811-83166833 CCCACTCCTAGCTCCATTGGCAA No data
Right 1027830169 7:83166834-83166856 TATGGCCTACGGGACTTTGTAGG No data
1027830162_1027830168 -10 Left 1027830162 7:83166811-83166833 CCCACTCCTAGCTCCATTGGCAA No data
Right 1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830162 Original CRISPR TTGCCAATGGAGCTAGGAGT GGG (reversed) Intergenic
No off target data available for this crispr