ID: 1027830168

View in Genome Browser
Species Human (GRCh38)
Location 7:83166824-83166846
Sequence CCATTGGCAATATGGCCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830162_1027830168 -10 Left 1027830162 7:83166811-83166833 CCCACTCCTAGCTCCATTGGCAA No data
Right 1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG No data
1027830160_1027830168 23 Left 1027830160 7:83166778-83166800 CCACTTATTTTTGAAAAGGGAAA No data
Right 1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830168 Original CRISPR CCATTGGCAATATGGCCTAC GGG Intergenic
No off target data available for this crispr