ID: 1027830541

View in Genome Browser
Species Human (GRCh38)
Location 7:83171519-83171541
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830541_1027830547 3 Left 1027830541 7:83171519-83171541 CCATTTCCCCTTCAGAAGTGACT No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data
1027830541_1027830550 21 Left 1027830541 7:83171519-83171541 CCATTTCCCCTTCAGAAGTGACT No data
Right 1027830550 7:83171563-83171585 AGGGGACTTAATGTGTTCCATGG No data
1027830541_1027830546 2 Left 1027830541 7:83171519-83171541 CCATTTCCCCTTCAGAAGTGACT No data
Right 1027830546 7:83171544-83171566 AGATGAGAAGCCAAGTGCCAGGG No data
1027830541_1027830545 1 Left 1027830541 7:83171519-83171541 CCATTTCCCCTTCAGAAGTGACT No data
Right 1027830545 7:83171543-83171565 GAGATGAGAAGCCAAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830541 Original CRISPR AGTCACTTCTGAAGGGGAAA TGG (reversed) Intergenic