ID: 1027830543

View in Genome Browser
Species Human (GRCh38)
Location 7:83171526-83171548
Sequence CATCTCTAGTCACTTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830543_1027830546 -5 Left 1027830543 7:83171526-83171548 CCCTTCAGAAGTGACTAGAGATG No data
Right 1027830546 7:83171544-83171566 AGATGAGAAGCCAAGTGCCAGGG No data
1027830543_1027830550 14 Left 1027830543 7:83171526-83171548 CCCTTCAGAAGTGACTAGAGATG No data
Right 1027830550 7:83171563-83171585 AGGGGACTTAATGTGTTCCATGG No data
1027830543_1027830545 -6 Left 1027830543 7:83171526-83171548 CCCTTCAGAAGTGACTAGAGATG No data
Right 1027830545 7:83171543-83171565 GAGATGAGAAGCCAAGTGCCAGG No data
1027830543_1027830547 -4 Left 1027830543 7:83171526-83171548 CCCTTCAGAAGTGACTAGAGATG No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830543 Original CRISPR CATCTCTAGTCACTTCTGAA GGG (reversed) Intergenic