ID: 1027830544

View in Genome Browser
Species Human (GRCh38)
Location 7:83171527-83171549
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830544_1027830547 -5 Left 1027830544 7:83171527-83171549 CCTTCAGAAGTGACTAGAGATGA No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data
1027830544_1027830546 -6 Left 1027830544 7:83171527-83171549 CCTTCAGAAGTGACTAGAGATGA No data
Right 1027830546 7:83171544-83171566 AGATGAGAAGCCAAGTGCCAGGG No data
1027830544_1027830550 13 Left 1027830544 7:83171527-83171549 CCTTCAGAAGTGACTAGAGATGA No data
Right 1027830550 7:83171563-83171585 AGGGGACTTAATGTGTTCCATGG No data
1027830544_1027830545 -7 Left 1027830544 7:83171527-83171549 CCTTCAGAAGTGACTAGAGATGA No data
Right 1027830545 7:83171543-83171565 GAGATGAGAAGCCAAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830544 Original CRISPR TCATCTCTAGTCACTTCTGA AGG (reversed) Intergenic