ID: 1027830547

View in Genome Browser
Species Human (GRCh38)
Location 7:83171545-83171567
Sequence GATGAGAAGCCAAGTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027830541_1027830547 3 Left 1027830541 7:83171519-83171541 CCATTTCCCCTTCAGAAGTGACT No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data
1027830542_1027830547 -3 Left 1027830542 7:83171525-83171547 CCCCTTCAGAAGTGACTAGAGAT No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data
1027830543_1027830547 -4 Left 1027830543 7:83171526-83171548 CCCTTCAGAAGTGACTAGAGATG No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data
1027830544_1027830547 -5 Left 1027830544 7:83171527-83171549 CCTTCAGAAGTGACTAGAGATGA No data
Right 1027830547 7:83171545-83171567 GATGAGAAGCCAAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027830547 Original CRISPR GATGAGAAGCCAAGTGCCAG GGG Intergenic