ID: 1027835843

View in Genome Browser
Species Human (GRCh38)
Location 7:83240808-83240830
Sequence GCATCCAACAAGTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027835843_1027835847 20 Left 1027835843 7:83240808-83240830 CCTGCTTTAAACTTGTTGGATGC No data
Right 1027835847 7:83240851-83240873 CCATCAATTTTCTGTTTTTCGGG No data
1027835843_1027835848 28 Left 1027835843 7:83240808-83240830 CCTGCTTTAAACTTGTTGGATGC No data
Right 1027835848 7:83240859-83240881 TTTCTGTTTTTCGGGATCCATGG No data
1027835843_1027835845 19 Left 1027835843 7:83240808-83240830 CCTGCTTTAAACTTGTTGGATGC No data
Right 1027835845 7:83240850-83240872 TCCATCAATTTTCTGTTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027835843 Original CRISPR GCATCCAACAAGTTTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr