ID: 1027842254

View in Genome Browser
Species Human (GRCh38)
Location 7:83327904-83327926
Sequence ATAAAATTCTTGGAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027842248_1027842254 -1 Left 1027842248 7:83327882-83327904 CCACAAAAGGAACCTATGTATCA No data
Right 1027842254 7:83327904-83327926 ATAAAATTCTTGGAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027842254 Original CRISPR ATAAAATTCTTGGAAGGGGC TGG Intergenic
No off target data available for this crispr