ID: 1027842763

View in Genome Browser
Species Human (GRCh38)
Location 7:83335024-83335046
Sequence GTTCCTACTTCAAATGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027842763_1027842770 25 Left 1027842763 7:83335024-83335046 CCAAACCCATTTGAAGTAGGAAC No data
Right 1027842770 7:83335072-83335094 ATATCAATGAGCAGATTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027842763 Original CRISPR GTTCCTACTTCAAATGGGTT TGG (reversed) Intergenic
No off target data available for this crispr