ID: 1027842770

View in Genome Browser
Species Human (GRCh38)
Location 7:83335072-83335094
Sequence ATATCAATGAGCAGATTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027842764_1027842770 20 Left 1027842764 7:83335029-83335051 CCCATTTGAAGTAGGAACAATTT No data
Right 1027842770 7:83335072-83335094 ATATCAATGAGCAGATTCTATGG No data
1027842763_1027842770 25 Left 1027842763 7:83335024-83335046 CCAAACCCATTTGAAGTAGGAAC No data
Right 1027842770 7:83335072-83335094 ATATCAATGAGCAGATTCTATGG No data
1027842765_1027842770 19 Left 1027842765 7:83335030-83335052 CCATTTGAAGTAGGAACAATTTG No data
Right 1027842770 7:83335072-83335094 ATATCAATGAGCAGATTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027842770 Original CRISPR ATATCAATGAGCAGATTCTA TGG Intergenic
No off target data available for this crispr