ID: 1027844617

View in Genome Browser
Species Human (GRCh38)
Location 7:83356833-83356855
Sequence CCTCAAATGCAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027844611_1027844617 23 Left 1027844611 7:83356787-83356809 CCCTGAAATACTTCACCTATAGT No data
Right 1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG No data
1027844612_1027844617 22 Left 1027844612 7:83356788-83356810 CCTGAAATACTTCACCTATAGTA No data
Right 1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG No data
1027844613_1027844617 8 Left 1027844613 7:83356802-83356824 CCTATAGTAACTAGCTTTCTATG No data
Right 1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027844617 Original CRISPR CCTCAAATGCAGAAAGAAGA AGG Intergenic
No off target data available for this crispr