ID: 1027851009

View in Genome Browser
Species Human (GRCh38)
Location 7:83451970-83451992
Sequence CAGAAGAAGGAGAACGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 533}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027851009_1027851012 -5 Left 1027851009 7:83451970-83451992 CCACACTCGTTCTCCTTCTTCTG 0: 1
1: 0
2: 1
3: 42
4: 533
Right 1027851012 7:83451988-83452010 TTCTGGTTTGCTGTAGCCTCAGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027851009 Original CRISPR CAGAAGAAGGAGAACGAGTG TGG (reversed) Intronic
901412312 1:9093056-9093078 CAGAAGAGGGGAAACGAGAGGGG - Intergenic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
903145807 1:21371258-21371280 AAGAAGAAGAAGAAGGAGTTGGG + Intergenic
903443581 1:23406426-23406448 CAGATCAAGGAGAACGATTAGGG - Intronic
903824191 1:26130865-26130887 CAGAAGAATGAGCACCTGTGAGG - Intergenic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904413734 1:30342322-30342344 CAGAAGACGGTGAAGAAGTGAGG - Intergenic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
904920580 1:34004892-34004914 AGGAAGAAGGAGAGCGAGTGAGG - Intronic
905617122 1:39408951-39408973 CACAGGAAGGAGGACGAGGGCGG - Intronic
905634526 1:39540825-39540847 CGTAAGAAGGAGCACGAGAGAGG + Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906860004 1:49349417-49349439 GAGAAGGAGGAGAACAAGGGAGG - Intronic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907448022 1:54521808-54521830 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907984666 1:59518670-59518692 CAGAAGCAAGAGAGAGAGTGGGG - Intronic
908865666 1:68546740-68546762 CAGAGGCAAGAGAAAGAGTGGGG + Intergenic
909399361 1:75209449-75209471 TGGAAGAAGGAGCACGAGTAAGG - Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
909684483 1:78331857-78331879 AAGAAGAAAGAGAAGGAGAGAGG - Intronic
910696762 1:90026637-90026659 CAAAAGAAGGAATACTAGTGAGG - Intronic
911313388 1:96325725-96325747 CAGAAAAAGGAGAATGGATGGGG - Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
914204782 1:145517552-145517574 AAGAAGAAGAGGAAGGAGTGTGG + Intergenic
914370780 1:147022675-147022697 AAGAAGAAGAGGAAGGAGTGTGG - Intergenic
914455848 1:147835564-147835586 TAAAAGAAGGAGGAAGAGTGAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
916665120 1:166959563-166959585 CAAAAGAAGGAAAAAAAGTGGGG + Intronic
916851877 1:168712337-168712359 CAGGAGCAGGGGAAAGAGTGAGG - Intronic
917496459 1:175544752-175544774 AGGTAGAAGGAGAACCAGTGTGG + Intronic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918440192 1:184559274-184559296 CAGGAGCAGGAGAGAGAGTGGGG - Intronic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919378567 1:196824719-196824741 CAGACGAAGTGAAACGAGTGGGG + Intronic
919553953 1:199028574-199028596 CAAGAGCAGGAGAATGAGTGGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920988640 1:210914695-210914717 CAGAAGAACTAGAAGGAGAGAGG + Intronic
921131936 1:212227394-212227416 CAGAAGAGGGAGGATGAGAGAGG - Intergenic
921169307 1:212532268-212532290 CAGAAAAAGGAGATCCACTGAGG - Intergenic
921344645 1:214169885-214169907 CAGAAGCAAGAGACAGAGTGGGG + Intergenic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922719747 1:227894162-227894184 CAGGAGAAGGGGAGCAAGTGGGG + Intergenic
924375895 1:243408493-243408515 AAGAAGAAGGAGAACTAGCTTGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924614473 1:245601165-245601187 CAGTAGAAGGAGCCCGAGTGTGG - Intronic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063010299 10:2015168-2015190 AAGAAGAATGAGAAAGAGAGAGG - Intergenic
1063216289 10:3928976-3928998 CAGGAGAAGGAGAAAGGGAGGGG + Intergenic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065655659 10:27946738-27946760 CATAAGAAGGAGGAGGTGTGTGG - Intronic
1065966987 10:30778727-30778749 AAGAAGAAGGATAAGGAGGGGGG + Intergenic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1067251849 10:44593306-44593328 CAGGAGAGGGAGAAAGAGAGAGG + Intergenic
1068052517 10:51968356-51968378 CAGAAGAAAGAGCAGGACTGTGG + Intronic
1069362973 10:67664611-67664633 AAGAAGAAAGAAAACAAGTGTGG - Intronic
1069374155 10:67776905-67776927 CAGAAGAAGGGAGATGAGTGAGG - Intergenic
1069859664 10:71462428-71462450 GAGGAGAAGGAGGAAGAGTGGGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1071231985 10:83598550-83598572 CAGAAAAATGAGAATGTGTGTGG - Intergenic
1072165666 10:92810435-92810457 CAGAAGAGGGTCAAGGAGTGTGG - Intergenic
1073557836 10:104470370-104470392 CAGAAAAAGAAGAACAAGTTGGG - Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075163316 10:120043378-120043400 CAGGAGGAAGAGAACGAGAGGGG + Intergenic
1075378241 10:121996987-121997009 CTGGAGAAGGAGAAAGAGAGTGG + Intronic
1075627728 10:123974552-123974574 AAGGAGAAGGAGCAAGAGTGAGG - Intergenic
1076059343 10:127401315-127401337 CAGAAGAAGGAATTCGATTGAGG + Intronic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077724965 11:4665542-4665564 CAGAAGAAGGAGGAAAAATGTGG + Intergenic
1077975938 11:7249230-7249252 CAGAAGAATGAGAAACAATGTGG - Intronic
1078366401 11:10710179-10710201 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1078496128 11:11818909-11818931 GAGAGGAAGGAGAAAGACTGTGG - Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079145632 11:17848975-17848997 CAGAAGAAAGAGAGCTAGAGTGG - Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1079720379 11:23804478-23804500 CAGAAGAAGGAAAACTCTTGAGG - Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079795918 11:24802895-24802917 TAGAAGAAGGAGAAAGGATGAGG - Intronic
1080117655 11:28638844-28638866 CCGAAGAAGCACAAGGAGTGGGG + Intergenic
1080362980 11:31537651-31537673 CAGGAGGAAGAGAAAGAGTGGGG + Intronic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1084190477 11:67496357-67496379 CAGAAGACAGAGAAAGATTGTGG + Intronic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084386788 11:68848141-68848163 AGGTAGAAGGAGAACGAGAGAGG + Intergenic
1085211532 11:74784454-74784476 CAGTAGAGGGAGAAGGTGTGTGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086251891 11:84825796-84825818 ATGAAGAAGGTGAACAAGTGAGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086960609 11:92976575-92976597 CAAAAGAAGGAGATAGAGAGTGG - Intronic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1089034583 11:115373613-115373635 AAGAAGAAGAAGAAAGAATGTGG + Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1092076617 12:5678721-5678743 CAGGAGAAGGTGAAAGAGAGTGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092623639 12:10301935-10301957 GAGAAGAGGGAGAACGAGATGGG + Intergenic
1092785068 12:12019084-12019106 CAGAGGAATGAGATCGAGTTTGG - Intergenic
1092811609 12:12276116-12276138 CAGGAGAAAGAGAGAGAGTGAGG + Intergenic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095332853 12:40989827-40989849 CAGAAGAAGTATATTGAGTGTGG + Intronic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095785378 12:46103076-46103098 CTGAAAAAGGAGGACGAGAGAGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098370312 12:69752235-69752257 CAGAAGCAGGAGGACAATTGTGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098968081 12:76815961-76815983 CAGAAGAAGGCTAATGACTGTGG - Exonic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102320187 12:111926575-111926597 CAGAAGAAGGATCAAGAGGGAGG - Intergenic
1102517879 12:113462610-113462632 GAGAAGACGGAGAGCGAGCGAGG - Exonic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102861633 12:116341355-116341377 CAGGAGAGGGCGAACGAGAGAGG + Intergenic
1103233664 12:119353572-119353594 AAGAAGAAGAAGAAGGAGAGAGG - Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1104232518 12:126898790-126898812 AAGAAGGAGGAGAAAGAATGGGG + Intergenic
1105499321 13:20957720-20957742 AAAAAAAAAGAGAACGAGTGTGG + Intergenic
1105787332 13:23762550-23762572 CAGAAAGAGGAGAACGGATGTGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106853081 13:33816612-33816634 CTGAGGAAGGAGAAATAGTGTGG - Intergenic
1106985248 13:35339725-35339747 CAGAAGCAGGAGCAAGAGAGAGG + Intronic
1107143712 13:37034072-37034094 GAGAAGAAGGAGAAAGATAGGGG - Intronic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1108896574 13:55335637-55335659 CAGAAGCAAGAGAAAGAGAGTGG - Intergenic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109856223 13:68131395-68131417 CAGGAGCAGGAGGAAGAGTGGGG + Intergenic
1109959498 13:69612561-69612583 CAGAAGAAAGAAATCTAGTGAGG + Intergenic
1110475012 13:75903366-75903388 CAGAAGGAGGGGGACTAGTGGGG + Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113676254 13:112209758-112209780 GAGATGAAGGAGACCTAGTGGGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114898580 14:27026488-27026510 CAGAGGAAGGAGAGAGAGAGCGG - Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1116206442 14:41873379-41873401 CAGAAGAGAGAGAAAGAGAGAGG + Intronic
1117978162 14:61318753-61318775 TGGAAGAAGCAGCACGAGTGTGG - Intronic
1118634484 14:67735172-67735194 CTGAACAAGGGGAACGACTGTGG - Intronic
1119070864 14:71582381-71582403 CAGAAGAATGATAAAGAATGCGG - Intronic
1119269213 14:73287235-73287257 CAGAAGCGGGAGAAGGAATGTGG - Exonic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1119587859 14:75854205-75854227 CAGAAGAATGATTACTAGTGGGG - Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121905790 14:97741542-97741564 GAGAGGAAGGAGAAGCAGTGTGG - Intergenic
1122038153 14:98963166-98963188 CAGAAGAAGAAGAAGAAGAGAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1124075086 15:26436722-26436744 CAGAAGAAGCAGAGCCAGTAAGG - Intergenic
1124126171 15:26939609-26939631 CAGAAGCAGGCGAGGGAGTGGGG + Intronic
1124708255 15:31983376-31983398 CACAAGAAGGAGAACAAATATGG - Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126138539 15:45416467-45416489 GAAAAGAATGAGAACGAGAGAGG - Intronic
1126179792 15:45773958-45773980 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1126549104 15:49907786-49907808 CAGATGTAGGAGAAAGAGTATGG - Intronic
1127556388 15:60091498-60091520 CAGAAGAGAGAGACCCAGTGAGG - Intergenic
1127611328 15:60640383-60640405 CAGAAGGAGGAAAACCAGTTAGG - Intronic
1127799063 15:62462291-62462313 TGGAAGAAGGAGCACCAGTGTGG + Intronic
1128304121 15:66586951-66586973 GAGGAGAAGGAGGAAGAGTGGGG - Intronic
1128364254 15:66986125-66986147 AACCAGAAGGAGAAGGAGTGTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1131946180 15:97624417-97624439 CAGGAGAAATAGAGCGAGTGGGG - Intergenic
1132839813 16:1973548-1973570 AAGGAGAAGGGGCACGAGTGAGG + Intronic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1133439014 16:5805069-5805091 CAAAAGAAGGTGATCTAGTGTGG + Intergenic
1133646908 16:7773266-7773288 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1133898775 16:9953629-9953651 CAAAAGAAGGAGAGTGTGTGTGG + Intronic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1136062523 16:27736523-27736545 CAGAAGAAGGAGCAAGGCTGTGG + Intronic
1136736166 16:32469564-32469586 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1141158621 16:81613995-81614017 CAGAAGAAGGACAACTAGACAGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1203016906 16_KI270728v1_random:360010-360032 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1203035241 16_KI270728v1_random:633168-633190 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1146348585 17:32077298-32077320 CAGGAGCAGGAGAGAGAGTGGGG + Intergenic
1146796433 17:35784592-35784614 CAGTAGAAGGAGCAGGGGTGTGG + Intronic
1147631203 17:41933098-41933120 CAGCAGGAGGAGAATAAGTGGGG - Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149110655 17:53025416-53025438 CAGAAGAAAGAGAAGAAATGGGG - Intergenic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1149514715 17:57271847-57271869 CTGAAGGAGGGGAAAGAGTGAGG + Intronic
1150059464 17:62052686-62052708 TAGAAGAAGAAGATGGAGTGTGG - Exonic
1150557178 17:66264834-66264856 GAGAAGAATGAGAATGAGTGGGG - Intergenic
1151820940 17:76496465-76496487 CAGGAGAAAAAGAACGGGTGAGG + Intronic
1152307477 17:79529723-79529745 CAGAGGAAGGAGGGAGAGTGAGG + Intergenic
1152612328 17:81322006-81322028 AGGAAGAAGGACAACGAATGGGG - Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155632684 18:27912558-27912580 TAGAAAAAGGAGAATGAATGAGG - Intergenic
1156443039 18:37210949-37210971 CAGAAGAATCAGAAAGTGTGTGG - Intronic
1156819841 18:41359095-41359117 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157623041 18:49027045-49027067 CAGAGGCAGGGGGACGAGTGAGG + Intergenic
1157687735 18:49656312-49656334 CAGAAGAATTAGACCGTGTGAGG - Intergenic
1158031924 18:52976461-52976483 TAAATGAAGGATAACGAGTGGGG - Intronic
1158409084 18:57188509-57188531 CAGAGAAAGGAGAGCGAGAGAGG + Intergenic
1159060631 18:63510522-63510544 CAGGAAAATGAGAACAAGTGAGG + Intergenic
1159114881 18:64102756-64102778 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160238441 18:77104381-77104403 CAAAGGAAGGAGAACTGGTGAGG + Intronic
1161144598 19:2670271-2670293 CAGAGGAAGGAGCACCAGTGGGG + Intronic
1161308607 19:3581106-3581128 AAGAAGAAGAAGAAGCAGTGTGG - Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162549511 19:11350837-11350859 GAGAAGGAGGAGCACAAGTGGGG + Exonic
1163565051 19:18046228-18046250 CAGAGGAGGGAGAGAGAGTGTGG + Intergenic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164424542 19:28129217-28129239 CAGCAGCAGGAGAAAGAGAGAGG - Intergenic
1164441898 19:28285131-28285153 GGGAAGAAGGAGAAGGAGGGTGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1166105234 19:40594910-40594932 TGGAAGAAGGAGCAGGAGTGGGG + Intronic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
925011181 2:487690-487712 CAGCAGAACCAGAACGAATGCGG - Intergenic
925035817 2:684862-684884 CAGGAGAAAGAGAGAGAGTGAGG - Intergenic
925831877 2:7903911-7903933 CAGATGAAGGAGGTCCAGTGAGG - Intergenic
926283961 2:11472702-11472724 CAGGAGAAAGAGAGTGAGTGAGG + Intergenic
926560837 2:14415670-14415692 CAGGAGCAAGAGAAAGAGTGGGG - Intergenic
930031000 2:47057949-47057971 CACAAGGAGGAGAAAGAGTGGGG - Intronic
930087477 2:47508041-47508063 CAGAAGACGGAGACAGATTGAGG + Intronic
930565586 2:53015286-53015308 CAGAAGATGGAGACTGTGTGAGG + Intergenic
931079081 2:58748977-58748999 CAGATACAGGAGAATGAGTGGGG + Intergenic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
934047332 2:88183591-88183613 GGGAAGAAGGAGAGCGAGGGAGG - Intronic
934187332 2:89758678-89758700 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
934309302 2:91849260-91849282 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
936112136 2:109673736-109673758 TGGAAGAAGGAGAAAGAGAGAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936612254 2:114012664-114012686 CAGAAGCAAGAGAACCAGTAGGG + Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
938290754 2:130148849-130148871 CAGAAGAAGGAATTCGACTGAGG + Intergenic
938465792 2:131524104-131524126 CAGAAGAAGGAATTCGACTGAGG - Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938726131 2:134110067-134110089 CAGAAGAAGGAGATAAATTGAGG + Intergenic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940084448 2:149842548-149842570 CAGAAGAAGGAAGACCAGTTAGG - Intergenic
940691822 2:156927878-156927900 CAGAAGCAAGAGAAAGAGTGGGG + Intergenic
941918543 2:170828045-170828067 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918552 2:170828083-170828105 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
942458302 2:176152369-176152391 CAGAAGAAGGAGCACATTTGGGG + Intronic
942572635 2:177329318-177329340 CAGAAGGAAGAGAGAGAGTGGGG - Intronic
943513952 2:188862139-188862161 GAGAAGAAGGAATACCAGTGTGG + Intergenic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
946687181 2:222282104-222282126 CAGAAATAGGAGAACAAGTTAGG - Intronic
946740406 2:222795599-222795621 CATAAGAAAGAGAAAGAATGAGG - Intergenic
946914737 2:224506371-224506393 CAGGAGAATGAGAAACAGTGAGG - Intronic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
1168974428 20:1953393-1953415 CAGAAAGAGGAGAATGAATGGGG - Intergenic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1171233395 20:23505582-23505604 TTGAAGAATGAGAAAGAGTGGGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171333851 20:24365376-24365398 CAGAAGGTGGAGGACAAGTGAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172251587 20:33483371-33483393 CAGTAGAATGAGACCAAGTGTGG + Intergenic
1172849422 20:37950003-37950025 CAGGAGCAAGAGAGCGAGTGGGG + Intergenic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1174276259 20:49406774-49406796 CAGAAGAGGGTGGAAGAGTGAGG - Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174639449 20:52030693-52030715 GAGAAGAAGGAGAACAACTCAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1177783521 21:25644499-25644521 CAGAAGAGAGAGAACAAGAGAGG - Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178910270 21:36668385-36668407 AAGAAGAAGGAGAAAAAATGAGG - Intergenic
1179214285 21:39352854-39352876 AAGAAGAATGAAAATGAGTGAGG + Intergenic
1179348000 21:40579309-40579331 CAGAAGAAAAAGAAGCAGTGAGG + Intronic
1179969755 21:44828583-44828605 CAGAAGAAGAAGAGAGAATGAGG + Intergenic
1180536385 22:16396370-16396392 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1180691830 22:17723181-17723203 CAGGAGAGGGAGAAAGAGAGAGG - Intronic
1182677325 22:32049849-32049871 TAGAAGAAGGTGCACGAATGGGG + Intronic
1182907400 22:33950013-33950035 CTGAAGAAGGAGAAACAGAGGGG - Intergenic
1183731152 22:39619284-39619306 CAGAGAAAGGAGAGAGAGTGAGG - Intronic
1184502742 22:44883586-44883608 CAGGAGGAGGAGGAAGAGTGTGG - Intronic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949464875 3:4333734-4333756 AAGAAGAAGGAGGAATAGTGTGG + Intronic
950164112 3:10780698-10780720 CATAAGCAGGAGAATGACTGGGG - Intergenic
951117334 3:18880392-18880414 CAGAAGGAGGAGAAAAAGAGAGG + Intergenic
952277559 3:31892181-31892203 CAGAGGAAGGAGCACGTGTATGG + Intronic
952596406 3:35023844-35023866 CAGTAGAATGAGAACCAGGGTGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953423380 3:42772513-42772535 AAGAAGAAAGAGAAGGAGAGGGG - Intronic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
954097084 3:48337238-48337260 CAGGAGGAAGAGAACGAATGGGG - Intergenic
954984547 3:54778137-54778159 CAGAAGGAAGAGAGAGAGTGGGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956777219 3:72575315-72575337 CAGGAGAATGAGAACAAGTGGGG + Intergenic
956811289 3:72866339-72866361 TAGAAGATGGAGAAAGAGGGAGG - Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958444200 3:94194835-94194857 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
959037318 3:101383225-101383247 CAGGAGCAAGAGAAAGAGTGGGG - Intronic
959202056 3:103259689-103259711 CAGAAGCAAGAGAGAGAGTGAGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
961030572 3:123599990-123600012 AAGAAGGAGGAGGAAGAGTGGGG - Intergenic
961854434 3:129855512-129855534 CAGAAAAAGGAGAAGAAATGAGG + Intronic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962958332 3:140286785-140286807 TAGAAGAAGGAGGAGTAGTGGGG + Intronic
963699208 3:148602669-148602691 TAGTAGAATGAGAAAGAGTGGGG - Intergenic
964021562 3:152019685-152019707 CACAAGCAGGAGAGAGAGTGAGG - Intergenic
964446267 3:156762298-156762320 CAGAAGAAAGAGAACATGTGTGG + Intergenic
964447138 3:156771340-156771362 CAGCAGAAGGAGAAAATGTGAGG - Intergenic
965157533 3:165083509-165083531 CAGAAGAAGGTGAACGATCTAGG - Intergenic
965349261 3:167593921-167593943 CAGGAGAGGCAGAACGAGAGAGG - Intronic
965991304 3:174821885-174821907 CAGAAGAAGGACAGCTAGGGAGG + Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
968345454 3:198001044-198001066 CAGAAGGATGAGCACTAGTGAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969702288 4:8774174-8774196 TAATAGAAGGAGAAGGAGTGGGG - Intergenic
970015483 4:11507844-11507866 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
970749641 4:19342200-19342222 CAGAAGCAAGAGAGCGAGGGAGG - Intergenic
971388166 4:26160692-26160714 GAGTAAAAGGAGAAAGAGTGTGG + Intergenic
973548801 4:52010477-52010499 CACTAGAAGGAGGAGGAGTGTGG - Intronic
974110624 4:57521204-57521226 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
974421819 4:61685528-61685550 CTGAAGAATGAGAACGAGATAGG + Intronic
974672499 4:65050471-65050493 CTGAAGCAGGAGAAGGACTGCGG - Intergenic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
979140800 4:117171600-117171622 CAGGAGCAAGAGAAAGAGTGAGG - Intergenic
980261235 4:130450484-130450506 CAGAAGAAGCAGAACTAAAGTGG + Intergenic
980380157 4:132003364-132003386 CACAAGAAAGAGAAAGAGAGAGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982211458 4:153039925-153039947 CAGAAGAATGCGAGGGAGTGAGG + Intergenic
982567001 4:156998038-156998060 CAGGAGCACGAGAAAGAGTGAGG + Intergenic
983850160 4:172570312-172570334 CAGGAAAAGGATAACCAGTGGGG + Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985230887 4:187815186-187815208 CAGAAGAAAGAATACGACTGAGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985927512 5:3029478-3029500 CAGAAGAAGCAGAAGATGTGGGG + Intergenic
986091905 5:4516942-4516964 AAGAAGGAAGAGAAGGAGTGGGG - Intergenic
986150799 5:5128999-5129021 CAGAAGAAAGAGAGAGAGAGGGG - Intergenic
986669152 5:10127546-10127568 CAGAAGAAGGAGATAGACTATGG + Intergenic
986852098 5:11825492-11825514 CAGAAGAAGAGGAAAGAATGAGG + Intronic
987306771 5:16644700-16644722 CAGAAGCAAGAGTAAGAGTGAGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988390087 5:30616480-30616502 CAGAAGGAAGAGAGAGAGTGGGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
990896106 5:60701409-60701431 CAGAAGAAAGAGTTCGACTGAGG + Intergenic
992551757 5:77866253-77866275 CAGGAGACGGAGCAGGAGTGGGG + Intronic
992554273 5:77888229-77888251 CAGAAGAAGGAGAACCTGCTAGG - Intergenic
992930967 5:81644721-81644743 CATAAGAGGGAGAACCAGAGTGG + Intronic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993900855 5:93583726-93583748 CAGAAGAAGGAGCAAGAAAGAGG + Exonic
995137866 5:108700119-108700141 AAAAAGAAGGAGGCCGAGTGCGG + Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995291284 5:110458211-110458233 AAGAAGGAGGACAACAAGTGAGG - Intronic
995637402 5:114209302-114209324 CAGAGGAAGGGGAACTAGTAAGG - Intergenic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999628319 5:153543590-153543612 AGGAAGAAAGAGAAGGAGTGAGG + Intronic
1000453334 5:161418257-161418279 CAGAAGAAGAATAATGACTGAGG - Intronic
1000578685 5:163008964-163008986 CAGAGGGAGGAGAAAGAGAGTGG - Intergenic
1000614348 5:163411210-163411232 CAGAGGACGGAGAAGCAGTGTGG + Intergenic
1001469427 5:171999712-171999734 CAGAAGAAAAAGAAAGACTGAGG - Intronic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002394549 5:178942542-178942564 CAGAAGGAGGAGAGAGAATGGGG + Intronic
1002450366 5:179315104-179315126 CAGAAGAGAGAGAGTGAGTGAGG - Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003513463 6:6800393-6800415 AAGGAGAGGGAGAATGAGTGTGG - Intergenic
1004121495 6:12827032-12827054 AAGAAGGACGATAACGAGTGAGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004620342 6:17325765-17325787 CAGAAGAAAAGGAAAGAGTGTGG - Intergenic
1004873878 6:19935782-19935804 CAAATAAAGGAGAAAGAGTGTGG - Intergenic
1005675961 6:28155102-28155124 CAGATGGAGAATAACGAGTGAGG - Exonic
1005913095 6:30327394-30327416 AAGAAGATGGAGAACGGGGGTGG + Intronic
1006069931 6:31490908-31490930 AGGAAGAAGGAGCACGAGGGAGG - Intergenic
1006338740 6:33434165-33434187 CAGAAGCAGGGGAAAGAGTGAGG - Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008584797 6:52938734-52938756 GAGAAGAAGAAGAATGAATGGGG + Intergenic
1009513142 6:64578542-64578564 AAGTAGAAGTAGAACAAGTGTGG - Intronic
1011314048 6:86011554-86011576 CAGAAGAAGGAATTCGACTGAGG - Intergenic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1011957648 6:93043088-93043110 CTGAATTAGGAGAACCAGTGGGG - Intergenic
1012011532 6:93792796-93792818 TAGAAGAAGAAGAAGCAGTGTGG + Intergenic
1012695332 6:102374679-102374701 GAGTAGAAGGAGAAAGATTGGGG - Intergenic
1013141589 6:107341349-107341371 AAGAAGGAGGAGAACTAATGAGG + Intronic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015159444 6:130136150-130136172 CAGAAGCAGGAAAATGAGTTTGG - Intronic
1016413228 6:143805557-143805579 AACCAGAAGGAGAAAGAGTGAGG - Intronic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017354646 6:153489164-153489186 CAGAAGGAAGTGAAGGAGTGTGG - Intergenic
1017869352 6:158473751-158473773 CTGAAGCAGGAGAATCAGTGAGG - Intronic
1018063700 6:160110416-160110438 CAGACGAAAGACAACAAGTGTGG + Intronic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1019593999 7:1850103-1850125 CAGATTAAGGCGAACGAGAGTGG - Intronic
1019972220 7:4550206-4550228 AAGAGGAGGGAGAACGAGTTTGG + Intergenic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022163070 7:27731388-27731410 CAGAAGAAGCAGAAACAGAGAGG - Intergenic
1022553996 7:31273185-31273207 GACAAGAAGGATAAGGAGTGGGG - Intergenic
1022979193 7:35588168-35588190 CAGGAGAGAGAGAAAGAGTGAGG - Intergenic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023478425 7:40606165-40606187 AAGAAGAAGGACAAAGAGAGTGG + Intronic
1024525813 7:50348320-50348342 AGGAAGAAGGAGAAGGAGAGGGG + Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1026497033 7:70912332-70912354 CAGAAGAAAGAGAAAGAATGAGG + Intergenic
1026679033 7:72451378-72451400 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1026946277 7:74318231-74318253 CAGAAGAGGGAGAGAGCGTGGGG + Intronic
1027174779 7:75896409-75896431 CTGCAGAATGAGAAAGAGTGAGG + Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029939590 7:104465605-104465627 AAGAAGAATGAGAGCAAGTGGGG + Intronic
1031083947 7:117283864-117283886 CAGAAGATGGAAAATGAGAGAGG + Intronic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031934327 7:127720602-127720624 CAGAAGAAAAAGAACTAGTCTGG - Intronic
1032269283 7:130388896-130388918 CAGGAGAATGGGAAGGAGTGGGG - Intergenic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1033142150 7:138837287-138837309 CAGAAGAAGGAGGAAGAATGCGG + Intronic
1033245052 7:139710869-139710891 CTGGAGAAGGAGAAAGAGAGAGG - Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034275844 7:149823532-149823554 AAGAAGGAGGAGCAGGAGTGTGG - Intergenic
1034407281 7:150913468-150913490 CAGAGGAAGGAGAGAGAGAGGGG - Intergenic
1034785752 7:153924634-153924656 GAGAAGTAGGAGAACAACTGTGG + Intronic
1036777251 8:11622109-11622131 AAGAAGAAGAAGAAGAAGTGAGG - Intergenic
1037158104 8:15731126-15731148 CAGAAGAAGGAGATTTAGAGTGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037699100 8:21256228-21256250 AAGAAGAACAAGAATGAGTGAGG - Intergenic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038194521 8:25354627-25354649 CATAAGAAGGAAAAAAAGTGAGG + Intronic
1039285397 8:36034405-36034427 CAGAAGGAAGAGAGTGAGTGGGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041659990 8:60392069-60392091 CAGAAGGAGGCGAGGGAGTGAGG - Intergenic
1042398779 8:68321558-68321580 CAGTAAAAGAAGAATGAGTGTGG + Intronic
1042749222 8:72139948-72139970 CAGGAGGAGGAGAAAGAGTGGGG - Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043585227 8:81760853-81760875 CAGAAGACAGAGAAAGAGAGAGG + Intergenic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046133765 8:109999496-109999518 CATAAGGAGGAGAAATAGTGGGG + Intergenic
1046186617 8:110729762-110729784 TAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1047574609 8:126138955-126138977 CAGAAGTAGGAGCAAGAGAGAGG - Intergenic
1047873433 8:129109952-129109974 CAGAAGAATGAAAATGAGAGGGG - Intergenic
1048172170 8:132117665-132117687 CAGAAGAGGGAAAGAGAGTGAGG + Intergenic
1048735584 8:137497341-137497363 CAGATGAAGGAAAACTAATGAGG - Intergenic
1049293565 8:141817501-141817523 GAGATGAAGGAGAAAGGGTGGGG - Intergenic
1049699148 8:143999960-143999982 CAGAAGGAGTAGAAAGAATGGGG + Intronic
1050109715 9:2201779-2201801 CAGGAGAAAGAGAGCCAGTGGGG + Intergenic
1050125043 9:2348016-2348038 CAGGAGAAGGAGCAAGAGTGGGG - Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1052179504 9:25506677-25506699 AAGAAGAAAGAGAAAGGGTGGGG + Intergenic
1052337175 9:27331825-27331847 GAGAAAAAGGAGACTGAGTGTGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1053084671 9:35208601-35208623 CAGAAGCAAGAGCAAGAGTGGGG + Intronic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053290881 9:36879076-36879098 CAGAGGAGGGTGCACGAGTGTGG - Intronic
1055081827 9:72275271-72275293 CACAAGAATGGGAAGGAGTGAGG + Intergenic
1058159505 9:101552549-101552571 AAGAAGAACGAGAACGAGAAAGG + Exonic
1058556404 9:106173312-106173334 AAGAAGAAGGAGAACAAGAAGGG - Intergenic
1058797821 9:108515735-108515757 CAGGAGAGAGAGAAAGAGTGAGG + Intergenic
1059174395 9:112155870-112155892 AGGAAGAAGGAGAAGGAGAGAGG + Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060871467 9:127044725-127044747 TAGAGGAAGGAGAGAGAGTGTGG - Intronic
1060875262 9:127078545-127078567 CAGTAGAAGGAAAACATGTGGGG + Intronic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061486543 9:130923317-130923339 CAGAAGAAAAAGGAGGAGTGTGG - Intronic
1061737317 9:132670382-132670404 CAGAAAAAGGACAGCGAGCGGGG - Exonic
1185821800 X:3212274-3212296 CAGAAGCAGGAGCAAGAGCGGGG - Intergenic
1186074007 X:5856326-5856348 AAGAAGAAGGAAAACAAGAGTGG + Intronic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186981029 X:14957689-14957711 CTGAAGCAGGAGATCGATTGAGG - Intergenic
1187084530 X:16028251-16028273 CAGAAGAAAGAGTTCGACTGAGG - Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188033208 X:25287805-25287827 AAGAAGAAGGAAAAAGAGAGGGG - Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188606892 X:32042395-32042417 GGCAAGAAGGAGAATGAGTGAGG + Intronic
1188811172 X:34656363-34656385 GAGAGGAAGGAAAAAGAGTGGGG + Intronic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1192030142 X:67501992-67502014 CAGACTAAGGAGAAAGAATGAGG + Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1194949426 X:100107315-100107337 CAAAAGCAGGAGCAAGAGTGAGG - Intergenic
1194992903 X:100564044-100564066 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1195011970 X:100741432-100741454 CAGAAGCAGTAGAACAAGTAGGG + Intergenic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195778184 X:108431256-108431278 AAGTATAAGGAGAACTAGTGAGG + Intronic
1197875558 X:131100971-131100993 CAAAAGAAGGAAAACCACTGGGG - Intergenic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199055054 X:143284300-143284322 CAGAAGAAAGAATTCGAGTGAGG + Intergenic
1199261305 X:145778734-145778756 CAGAAGCAAGAGAGCGAGTGGGG - Intergenic
1200112550 X:153749199-153749221 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201257135 Y:12119368-12119390 CAGAAGCAGGAGCAAGAGCGGGG + Intergenic
1201453017 Y:14136382-14136404 GAGAAGGAAGAGAAAGAGTGAGG - Intergenic
1201693440 Y:16795384-16795406 CACAAGAAGGACAATGAGTGTGG + Intergenic
1202374423 Y:24220622-24220644 GAGAAGAAAGAGAAAGAGAGAGG + Intergenic
1202496357 Y:25449498-25449520 GAGAAGAAAGAGAAAGAGAGAGG - Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic