ID: 1027853137

View in Genome Browser
Species Human (GRCh38)
Location 7:83474246-83474268
Sequence CCCATTATTACTCATGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027853137 Original CRISPR CCCATTATTACTCATGTATC AGG (reversed) Intronic
902906788 1:19564107-19564129 CCCATTATTACTTAGGGAACTGG + Intergenic
906289151 1:44608731-44608753 TCCATCATTACCCATATATCTGG - Intronic
908022169 1:59909209-59909231 CCTATTTTTACTCCTGTAGCAGG + Intronic
909150743 1:72001027-72001049 CCCTTTACTACACATGTGTCGGG - Intronic
909857446 1:80554945-80554967 CCCAATATTACTAATTTATTTGG - Intergenic
912900948 1:113647839-113647861 ACCAGTATTAATAATGTATCAGG - Intronic
913162731 1:116159739-116159761 CCCAATATTCCTCTTGTTTCTGG - Intergenic
916955062 1:169823679-169823701 CTAATTATTACTCCTGTATAAGG - Intronic
923338209 1:232987623-232987645 CCCATTATTCATTATGCATCTGG + Intronic
923590607 1:235315627-235315649 GCCATTATTACTGATTTATAAGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065922699 10:30407172-30407194 ACAACTATTACTCATTTATCAGG + Intergenic
1066680176 10:37930522-37930544 ACCATTACTATTCATGTAACAGG + Intergenic
1078472513 11:11602889-11602911 CCCATTTTGACTCCTGTACCTGG - Intronic
1079910923 11:26308445-26308467 CACATCATTATTCATTTATCTGG + Intergenic
1080226767 11:29970549-29970571 CCCATTATTAAACATGACTCTGG - Intergenic
1086257256 11:84892233-84892255 CCCAATATGACTCAATTATCTGG - Intronic
1086569287 11:88263814-88263836 CCCATTGTTTCTCATGTGTCAGG - Intergenic
1087408307 11:97757024-97757046 CTCTTTCTTACTCATGTATCTGG + Intergenic
1088698251 11:112388806-112388828 CCCCTTACTGCTCATGTGTCAGG - Intergenic
1091111604 11:132974055-132974077 CGCATAATCACTCATGTCTCTGG + Intronic
1093699559 12:22203596-22203618 CCTGTTATTACTTCTGTATCAGG - Intronic
1102859005 12:116319272-116319294 CCCACTCGTACTCATGGATCTGG + Intergenic
1109372810 13:61446241-61446263 CTTATTATTTCTCATGTTTCTGG + Intergenic
1111128380 13:83941901-83941923 CCCCTTACTGCTCATGTATCAGG - Intergenic
1119110375 14:71967850-71967872 CCCATCATTACTCATATGTCAGG - Intronic
1121264199 14:92588623-92588645 CCCCTTAATACTCTTGCATCAGG + Intronic
1126177241 15:45747555-45747577 GCATTTATTACTCATGTGTCTGG + Intergenic
1128004903 15:64229698-64229720 GACATTATTAGTCCTGTATCTGG + Intronic
1132884308 16:2175817-2175839 CCCACGATTACTCATAGATCTGG + Exonic
1134333694 16:13273859-13273881 TCCATGGTTACCCATGTATCTGG + Intergenic
1142705647 17:1692238-1692260 CCCATCATTACTCTTCTTTCCGG + Intergenic
1144390372 17:14787955-14787977 CCCATTCTTTCTCATGAATGGGG + Intergenic
1145876882 17:28325669-28325691 CCCATTTTTACTCAGAAATCAGG + Intronic
1147847655 17:43416316-43416338 TCCATTCTGACCCATGTATCAGG + Intergenic
1150916821 17:69445760-69445782 CCAATTATTACACATAAATCAGG - Intronic
1151055003 17:71020865-71020887 TACATTAGTACTCATGTAGCAGG + Intergenic
1151081133 17:71330162-71330184 CCAATTATTACTCATTACTCAGG - Intergenic
1153365627 18:4252340-4252362 CCCCAAATTGCTCATGTATCAGG - Intronic
1155512233 18:26589661-26589683 CCCATTTTTATTCAGATATCTGG + Intronic
1156304300 18:35862342-35862364 CCCTTTACTGCACATGTATCGGG - Intergenic
1165332352 19:35147691-35147713 CCCATTATTACTTATTTCTAAGG - Intronic
925028708 2:631981-632003 CCCAGTATCAACCATGTATCAGG + Intergenic
930318015 2:49820993-49821015 CGCATTATTACTCATGTTAGAGG + Intergenic
930707383 2:54518166-54518188 CCTATTATTACTCAGGTACATGG - Intronic
931825796 2:65999521-65999543 CCCAATATTACTATTGTAGCTGG - Intergenic
931969483 2:67569782-67569804 CCCATTATTGCAAATGTTTCGGG - Intergenic
932859754 2:75277926-75277948 ACATTTATTGCTCATGTATCTGG + Intergenic
933486461 2:82930686-82930708 CCAATGATTTCGCATGTATCCGG - Intergenic
938250301 2:129810262-129810284 ACTATAATTACTCATGTATTTGG + Intergenic
939800051 2:146697320-146697342 CCCCTTACTGCACATGTATCAGG + Intergenic
943403366 2:187446690-187446712 CCCATTTCTACACATGTGTCAGG + Intronic
943636840 2:190316553-190316575 TCCATTATTACTGATTTTTCTGG - Intronic
946775616 2:223137290-223137312 AACATTATTACATATGTATCTGG - Intronic
948921159 2:241066534-241066556 CCCATTCTTGCTCCTGTGTCTGG - Intronic
1169887363 20:10415129-10415151 CACATTATTATTAATGTGTCAGG - Intronic
1170013709 20:11756894-11756916 GCATTTATTACTCATCTATCAGG + Intergenic
1170268410 20:14496287-14496309 CCCATTATTATTTTTGTATGTGG - Intronic
1174987924 20:55476129-55476151 ACCATTATTAGGCATGTCTCAGG - Intergenic
1176674600 21:9766963-9766985 ACCATTATTGCTCACGAATCTGG + Intergenic
1181731203 22:24848206-24848228 CCCATTATGTCTCAAGCATCCGG + Intronic
949751954 3:7362776-7362798 CATAATATTACTCAAGTATCAGG - Intronic
964525086 3:157609167-157609189 CCCACCATGAATCATGTATCTGG + Intronic
968712365 4:2128185-2128207 CGCATTCTTACACATTTATCTGG - Exonic
969135788 4:5027700-5027722 CCCATCATCACTCCTGTAACAGG - Intergenic
970403015 4:15735904-15735926 GCCATTATTACTCTTATATTCGG - Intronic
979277392 4:118828967-118828989 CCAATTCTCACTCATGTTTCAGG + Intronic
983788760 4:171768146-171768168 ACCCTTAATATTCATGTATCTGG + Intergenic
984043249 4:174763922-174763944 CTCATTATGACTCATATATGAGG + Intronic
985400696 4:189590474-189590496 ACCATTATTGCTCACGAATCTGG - Intergenic
987396112 5:17425248-17425270 CCCATTTTTACTAATTTTTCAGG - Intergenic
989098370 5:37801845-37801867 CACCTTATTAAACATGTATCTGG + Intergenic
995404410 5:111778225-111778247 TGCATTATTACAAATGTATCTGG - Intronic
995824905 5:116285163-116285185 TCCATTTTTACTCTTGTTTCAGG - Intronic
997341180 5:133145743-133145765 CCCATTTTTACTCATATTTCTGG + Intergenic
1009324620 6:62335504-62335526 CCCATAATTAAAAATGTATCAGG + Intergenic
1009830154 6:68919937-68919959 CCCTTTATTAATCAAGAATCAGG + Intronic
1016294108 6:142555485-142555507 CCCATTGTTCCTCATGTCTTTGG - Intergenic
1021519274 7:21522959-21522981 CCCAATATTGCTCAGATATCTGG + Intergenic
1024298856 7:47869598-47869620 TCCATTATTGCTCATGTATATGG - Intronic
1024602673 7:50998288-50998310 CGCATTCTTGCTCATGTATTAGG - Intergenic
1027633621 7:80641301-80641323 TACATTTTTACTCATGTATAGGG + Intronic
1027853137 7:83474246-83474268 CCCATTATTACTCATGTATCAGG - Intronic
1035098540 7:156377427-156377449 CCCATGATTAATTATGCATCAGG - Intergenic
1035993660 8:4521297-4521319 CCTATCTTTACTCATTTATCTGG - Intronic
1037714496 8:21385622-21385644 CCCATTAGTACAAATGTATCTGG - Intergenic
1039998076 8:42552007-42552029 ATTATTATTATTCATGTATCAGG - Intronic
1046970405 8:120216725-120216747 GGCATCTTTACTCATGTATCTGG + Intronic
1050159863 9:2706849-2706871 TCCATTATTACTCAGTTATCAGG - Intergenic
1050197771 9:3106382-3106404 AACATTATTACTCATGACTCAGG + Intergenic
1059832741 9:118116724-118116746 CAGATTTTTACTCATCTATCAGG + Intergenic
1185825080 X:3242103-3242125 CCCATTGTTACTAATGGATGTGG + Intergenic
1186168532 X:6853072-6853094 CCTCTTATTGCTCATGTGTCAGG + Intergenic
1194567740 X:95514072-95514094 CCCAGTATTACACATCTAGCAGG - Intergenic
1196137570 X:112226701-112226723 GACATTATTATTCATGTATTTGG + Intergenic
1201254233 Y:12091342-12091364 CCCATTGTTACTAATGGATGTGG - Intergenic