ID: 1027855391

View in Genome Browser
Species Human (GRCh38)
Location 7:83504770-83504792
Sequence CTCTGGAAGCTATGAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027855385_1027855391 -10 Left 1027855385 7:83504757-83504779 CCACCCATGTTTTCTCTGGAAGC 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1027855391 7:83504770-83504792 CTCTGGAAGCTATGAAGGGAGGG 0: 1
1: 0
2: 4
3: 32
4: 290
1027855383_1027855391 0 Left 1027855383 7:83504747-83504769 CCTAAGAAGACCACCCATGTTTT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1027855391 7:83504770-83504792 CTCTGGAAGCTATGAAGGGAGGG 0: 1
1: 0
2: 4
3: 32
4: 290
1027855382_1027855391 21 Left 1027855382 7:83504726-83504748 CCTGTCGTGAGGCAAATAGTACC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1027855391 7:83504770-83504792 CTCTGGAAGCTATGAAGGGAGGG 0: 1
1: 0
2: 4
3: 32
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027855391 Original CRISPR CTCTGGAAGCTATGAAGGGA GGG Intronic
900215820 1:1481023-1481045 CACTGGTAGCTATGAGGGGCCGG - Intronic
900222958 1:1519077-1519099 CACTGGTAGCTATGAGGGGCCGG - Intronic
900822360 1:4899394-4899416 ATCTACAAGCTAAGAAGGGAGGG - Intergenic
901017544 1:6240727-6240749 CTCTGGAAGTACAGAAGGGAAGG + Intergenic
901241354 1:7695617-7695639 CTCTGGAACCAATGAAGTGGAGG - Intronic
903189339 1:21648058-21648080 CTTTGGCAGCTGGGAAGGGAGGG + Intronic
903387505 1:22937037-22937059 CTCTGCAAGGTAGGCAGGGAGGG - Intergenic
905680292 1:39865740-39865762 CTCAGGAGGCTAAGATGGGAGGG + Intronic
906597248 1:47090142-47090164 CACTTTAAGCTATGAAGAGAAGG - Intronic
907761434 1:57364935-57364957 ATCAGGATGCTATGAAGGAAAGG + Intronic
908249378 1:62253092-62253114 GTCTGGAAGCTCTTAAGAGAAGG - Exonic
908342810 1:63199401-63199423 ATCTAAAACCTATGAAGGGATGG - Intergenic
910155437 1:84212992-84213014 CTATGTAAGTTATGAAGTGATGG + Intronic
910301600 1:85712767-85712789 ATCTGGAAGCAATAAAGAGATGG - Intergenic
910481579 1:87663830-87663852 GTTTGGCAGCTATGAAGGAAAGG - Intergenic
911260323 1:95678250-95678272 CTGTGGATGCAATGAAAGGATGG - Intergenic
912227937 1:107757255-107757277 CTCTTGATGCCATGAAGGTAGGG - Exonic
912695241 1:111836650-111836672 CTCTGGAAGCTATGAGGAAATGG - Intronic
915249172 1:154576363-154576385 CAATGGTAGCTCTGAAGGGAGGG + Exonic
915507305 1:156366122-156366144 CCCTGGTAGCTCTGAAGGAATGG - Intronic
915630035 1:157146490-157146512 CTCTGGAAGCCAGAAAGGGTTGG - Intergenic
916397920 1:164412430-164412452 CTCTGGAGGCTATGATTGGTGGG - Intergenic
917442212 1:175078013-175078035 ATCTGGAAGCTGAGCAGGGAGGG + Intronic
920358114 1:205391282-205391304 CTCTGGAAGATATAGAGAGAAGG + Intronic
923925220 1:238619297-238619319 CTCTGTGTGCCATGAAGGGATGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1062854317 10:772203-772225 CTATGGAAGCTGCAAAGGGAAGG + Intergenic
1064340233 10:14478824-14478846 CACTGGATGCTATGGAGAGAGGG + Intergenic
1065039195 10:21673507-21673529 GTCTGGAAGCCAGGAAGGGGGGG + Exonic
1067481527 10:46602576-46602598 CTCAGGAAGCTGGGAAGGAATGG + Intergenic
1067613225 10:47739153-47739175 CTCAGGAAGCTGGGAAGGAATGG - Intergenic
1069560413 10:69425494-69425516 CTCTTGCAGCTATGAGGGGAAGG - Intergenic
1070046844 10:72846818-72846840 ACCAGGAAGCAATGAAGGGAAGG + Intronic
1070416069 10:76190702-76190724 CTCTGAATGCTAGGCAGGGAGGG - Intronic
1070616362 10:77972315-77972337 CTCTGGAGGCTGAGATGGGAAGG + Intronic
1071628636 10:87199257-87199279 CTCAGGAAGCTGGGAAGGAATGG - Intergenic
1072545691 10:96435766-96435788 CTCGAGAAGCTAGGAAAGGATGG - Intronic
1072968865 10:99999102-99999124 CTCTGTTAGCTGTGGAGGGAAGG - Intronic
1074016919 10:109543613-109543635 CTCTAGAAGCTGTCAGGGGATGG - Intergenic
1074160751 10:110834649-110834671 CTCTGACATCTGTGAAGGGAGGG - Intronic
1075245642 10:120819773-120819795 CTCTTGAAGCACTGATGGGAAGG + Intergenic
1075263561 10:120982331-120982353 GTCACGGAGCTATGAAGGGATGG - Intergenic
1078639225 11:13079758-13079780 CCCAGGAAGCCATGAAGAGAAGG + Intergenic
1079064897 11:17281222-17281244 CTCAGGAAGCTGAGATGGGAGGG - Intronic
1080102445 11:28475127-28475149 CTCTGGAAGGTGTAAAGGGAAGG + Intergenic
1080426823 11:32162816-32162838 CTCTTGAAGCTGGGAAGGGGAGG + Intergenic
1080605502 11:33861777-33861799 ATCAGGCAGCTATGAAGGGAAGG + Intronic
1082135152 11:48539916-48539938 GTCTGGAAGCTCTGGAGTGAAGG - Intergenic
1083580010 11:63818781-63818803 CTCTGGAAGGGAGGACGGGATGG - Exonic
1084804606 11:71570139-71570161 CTCTGAAAAAGATGAAGGGAGGG + Intergenic
1084805847 11:71578489-71578511 CTCTGAAAAAGATGAAGGGAGGG - Intergenic
1086060685 11:82696640-82696662 CTCTGGGACCTCTGAGGGGATGG - Intergenic
1086402774 11:86474119-86474141 GTCTGGGAGCTGGGAAGGGAAGG - Intronic
1086495850 11:87403850-87403872 CTCTGGAGGGTATTAGGGGAGGG + Intergenic
1086729657 11:90232155-90232177 CTCTAGAAGCTAGAAAGGGAAGG + Intergenic
1087127409 11:94641410-94641432 CTCTGGAAACCATGAAGGCTAGG + Intergenic
1087670878 11:101105310-101105332 CTCTGGAATCTAGGAAGGTAAGG + Intronic
1088623503 11:111711018-111711040 TTCTGGTAGTTTTGAAGGGATGG + Intronic
1090001601 11:122965376-122965398 CTCTGGAAAATATGAAGAAAGGG + Intergenic
1091178018 11:133579310-133579332 CTCTGGAAGCTGGGAAGGCCGGG + Intergenic
1093361139 12:18229818-18229840 CTGTGGAATCCATGAAGTGATGG + Intronic
1096544508 12:52328312-52328334 CTCTGGAAGCAGTGAGGGGCTGG + Intergenic
1096817742 12:54212278-54212300 CTCTGGAAGTCAAGAGGGGAAGG + Intergenic
1097026199 12:56057492-56057514 CTCTAGAAGCTGAAAAGGGAAGG - Intergenic
1097189821 12:57214320-57214342 TTCTGAAGGCTAAGAAGGGAAGG - Intergenic
1098048261 12:66425199-66425221 CTCTGGAAGCTAGAAAGCAATGG - Intronic
1098548250 12:71734282-71734304 CTCAGCAAGCTATGAATAGAAGG - Intergenic
1099399725 12:82188082-82188104 CTCTATGAGCTATGAAGGAATGG - Intergenic
1099747398 12:86722829-86722851 CTTTGGAGGTTATAAAGGGATGG + Intronic
1099837796 12:87929602-87929624 ATTTGGAGGCTACGAAGGGAAGG + Intergenic
1100180275 12:92077851-92077873 CACTGAAAGTGATGAAGGGAAGG - Intronic
1104706669 12:130952560-130952582 CGCTGGAAGAGGTGAAGGGAGGG - Intergenic
1105309885 13:19196930-19196952 CTCAGGAAGCTGAGATGGGAGGG + Intergenic
1106813488 13:33382516-33382538 CTCTGAAATCTATGAAGGGAGGG + Intergenic
1106820849 13:33463085-33463107 CTCTGGAAGTGATGCAGGGTAGG + Intergenic
1108594963 13:51941748-51941770 CTCTGGAAGCTCTCATGGAAAGG + Intronic
1109508695 13:63339159-63339181 CACTGGAATCTAAGAAGGAATGG - Intergenic
1109985835 13:69983657-69983679 CTCAGGAGGCTATGACAGGAGGG + Intronic
1111431351 13:88151427-88151449 CTCTGGAAGGGAGGATGGGAAGG + Intergenic
1112015129 13:95325378-95325400 CTCTGGAGGCTGAGATGGGAGGG + Intergenic
1112131196 13:96525389-96525411 CACTGGTAACTAGGAAGGGAGGG - Intronic
1112760721 13:102690925-102690947 TTCTGGAGGCTATGAAGAGATGG + Exonic
1113164451 13:107422912-107422934 CTCTAGAAGCTGGGAAGGCAAGG + Intronic
1113414283 13:110116208-110116230 CTCTGGAGGCTGGGAAGGGAAGG + Intergenic
1114482285 14:23043270-23043292 CTCTGGGAGTCATGAAAGGATGG - Exonic
1114689509 14:24567081-24567103 GTCTGGAAGCTGTGATGGGTTGG - Intergenic
1115009381 14:28525734-28525756 GTATGGAAGCTATGAGTGGATGG + Intergenic
1115889903 14:38014911-38014933 CTATGAAAGCAATGAAGGAAAGG + Intronic
1117477302 14:56109301-56109323 CTGTGCAAGATATGAAGGAACGG - Intergenic
1118720965 14:68593594-68593616 CTCTGGAGACTAAGAAGGAAGGG - Intronic
1119045835 14:71318220-71318242 CTGTGGAAGGAAGGAAGGGAGGG - Intergenic
1120503145 14:85321968-85321990 CTCTGGAAGCTATGGACAAAGGG - Intergenic
1121794892 14:96726536-96726558 CTCTGGAAGCTGGGAAAGGCAGG + Intergenic
1122177927 14:99934818-99934840 CTGTGCACGCTATGCAGGGAGGG - Intronic
1122282638 14:100633114-100633136 CTCTGGAAGCTAAAGAGGCAGGG - Intergenic
1124398258 15:29324207-29324229 CTCAGGAGGCTAAGATGGGAAGG - Intronic
1124512057 15:30335927-30335949 CTCTGGAAGCTGAAAAGGCAAGG + Intergenic
1124657516 15:31521112-31521134 CACTGGAAGCTATGACAGGCCGG + Intronic
1124730857 15:32194824-32194846 CTCTGGAAGCTGAAAAGGCAAGG - Intergenic
1124971873 15:34496225-34496247 CTCTGGAAGCGGCTAAGGGACGG + Intergenic
1127383954 15:58452506-58452528 CCCAGGATGCTATAAAGGGATGG - Intronic
1127399630 15:58573096-58573118 CTCTGGTCGCTGTGAGGGGAAGG - Intergenic
1129317568 15:74754666-74754688 CTTTGAAAGCAATGAAGGGTAGG - Intronic
1129555479 15:76503992-76504014 CTCAGGAGGCTAAGAAAGGAAGG - Intronic
1132681640 16:1144808-1144830 CTCTGGGAGCCTTGAAGAGAAGG - Intergenic
1132756272 16:1487023-1487045 CTCTGGAAGCTGGAAAGGGCGGG - Intronic
1132826212 16:1906986-1907008 CTGCAGAAGCTATGCAGGGAGGG - Intergenic
1132827517 16:1912534-1912556 CTCTGGAAGCGAGGACGGCAGGG - Intronic
1133879445 16:9766612-9766634 CTCTGGAAGCAGTGATGGCAGGG - Intronic
1134890248 16:17835181-17835203 GTCTGAAAGCTTTGAAGGCAAGG + Intergenic
1137711760 16:50571620-50571642 ATCTGGCAGCTCTGCAGGGAAGG - Intronic
1140227528 16:73090550-73090572 CTATGGAAGCAAGAAAGGGAGGG + Intergenic
1141481632 16:84310304-84310326 CTCTGGAAGACCTGAAGGAACGG + Intronic
1141900049 16:86985169-86985191 ATCTGGAAGCGATCGAGGGAGGG + Intergenic
1142049458 16:87948629-87948651 CTCAGGAAGCTAAAAAAGGAAGG - Intergenic
1143092733 17:4458685-4458707 GTCTGGAAGGAAGGAAGGGAAGG - Intronic
1143110310 17:4549161-4549183 CTCAGGAACCCGTGAAGGGAAGG - Intronic
1144129698 17:12234318-12234340 GGCTTGTAGCTATGAAGGGAAGG + Intergenic
1144673658 17:17147166-17147188 CTCTGTATGCTGTCAAGGGAGGG + Intronic
1145112556 17:20176634-20176656 CTCTAGAAGCTGGGAAGGCAAGG - Intronic
1146229552 17:31095472-31095494 CTCTGGAGGAAAGGAAGGGAAGG + Intronic
1146240584 17:31219102-31219124 CTCAGGAAGCAATGGAGGTAAGG + Exonic
1147388982 17:40097936-40097958 CTCTGAAGGAAATGAAGGGAAGG + Intronic
1148964920 17:51427043-51427065 CTCTGGAAGCTGGGATGGCAAGG + Intergenic
1149513216 17:57259169-57259191 CTCTGGTAGACATAAAGGGAAGG - Intronic
1149613542 17:57977222-57977244 CTCAGGAAGCTAAGGTGGGAGGG - Intronic
1149771125 17:59321816-59321838 CTCTGGAGGCTAAGATGGGAGGG + Intergenic
1150743150 17:67795800-67795822 CACTGGAAGCGATAAAAGGAAGG + Intergenic
1152308655 17:79535955-79535977 CTTAGGAAGCTGTGGAGGGAGGG - Intergenic
1152999269 18:438701-438723 CTTGGGAAGCTGAGAAGGGAGGG + Intronic
1154273070 18:12936655-12936677 CTCAGGAAGCTGAGATGGGAGGG - Intergenic
1154992834 18:21612464-21612486 CTCTGGGGGCTGTGAAGGGAGGG + Intronic
1155069912 18:22305802-22305824 CAGTGGAAGGTTTGAAGGGAGGG + Intergenic
1155079646 18:22395995-22396017 GTATGGAAGCTATAAATGGAAGG - Intergenic
1155680158 18:28477719-28477741 CTGTGGAAGGAAGGAAGGGAAGG - Intergenic
1155877810 18:31108213-31108235 CACTGAAGTCTATGAAGGGATGG + Intergenic
1158392156 18:57052570-57052592 GTCTGGAAGCTTATAAGGGAAGG - Intergenic
1159185797 18:64972106-64972128 CTCTGGAGGCTCTGGAGAGAAGG + Intergenic
1159243447 18:65774436-65774458 ATGTGGAAGATCTGAAGGGAAGG - Intronic
1159579894 18:70223550-70223572 CTCTGGAGGCTGAGATGGGAGGG + Intergenic
1161410582 19:4114991-4115013 CTCTGGCTGCTATGCAGGTAGGG - Intronic
1162451802 19:10759538-10759560 CTCAGGAAGGTATGCATGGAAGG - Intronic
1162735381 19:12744281-12744303 ATGTAGAATCTATGAAGGGATGG - Intronic
1163231615 19:16006870-16006892 CTGTGTAAGCGAGGAAGGGAAGG - Intergenic
1163688934 19:18728030-18728052 CTCTGGAGGCTCTGAAAGTAAGG - Intronic
1165111257 19:33503760-33503782 AGCTGGAGGCAATGAAGGGAGGG - Intronic
1165506255 19:36232390-36232412 CTCTGGAAAATATGAAGTAATGG - Intronic
1165645133 19:37429546-37429568 CTTTGGCAGCTATGAAGGGATGG + Intronic
1166097689 19:40551280-40551302 CTCTGGAGGCTGGGGAGGGAGGG + Intronic
1166336152 19:42108883-42108905 CTGTGAAAGCTGAGAAGGGACGG + Intronic
1166510589 19:43406352-43406374 CGCTGGATGCTATGTAGGGACGG - Exonic
1167934953 19:52898079-52898101 ATCTGGAAGTTGTCAAGGGAAGG + Intergenic
1168312440 19:55467709-55467731 CTCTGGAGGATGGGAAGGGAAGG + Intergenic
925108611 2:1314393-1314415 CTCTGAAAGCTGTTAAGTGAAGG - Intronic
925270620 2:2604700-2604722 CTCTGGATCCCATGAGGGGAGGG + Intergenic
926222800 2:10947450-10947472 GTCTGCAAGCCAAGAAGGGAAGG + Intergenic
927213080 2:20650667-20650689 CTCAGGGAGCTCTGAAAGGATGG + Intronic
929263525 2:39893599-39893621 TTCTGGAAGCAAGAAAGGGAGGG - Intergenic
929440427 2:41962068-41962090 CTCAGGAAGCTCTGCAGGTAAGG - Intergenic
929669043 2:43854707-43854729 CTGGGGAAGGAATGAAGGGAGGG + Intronic
930430053 2:51264473-51264495 TTCTGTAAGCTATGAAGGAAAGG + Intergenic
931079478 2:58753063-58753085 CTAGTGAAGCTATGAAGAGAGGG + Intergenic
932028447 2:68158335-68158357 CTCAGAAGGCTATGGAGGGACGG - Intronic
933897488 2:86824818-86824840 TTCTGGAAGCGATTCAGGGAAGG - Intronic
934638511 2:96011533-96011555 GTCTTAAAGCTAGGAAGGGAAGG - Intergenic
935042761 2:99449155-99449177 CTCTGGAAGCTGAGATGGGAGGG + Intronic
935623455 2:105148362-105148384 CTCTGGGAGCTCTGAGGGAAGGG + Intergenic
936140376 2:109935071-109935093 CTCTGGATACTATGAAGTGATGG - Intergenic
936177066 2:110233016-110233038 CTCTGGATACTATGAAGTGATGG - Intergenic
936204319 2:110436415-110436437 CTCTGGATACTATGAAGTGATGG + Intronic
937477842 2:122230670-122230692 CTCTTGATGCTATGCAGGGAAGG - Intergenic
937526203 2:122772858-122772880 CTCTGGAAGCTTTGACGCAAAGG - Intergenic
937828645 2:126395970-126395992 TTATGGAAGGGATGAAGGGATGG - Intergenic
942715094 2:178882773-178882795 GTCTGGAAGCTTGGAAGGAAAGG + Intronic
943794919 2:191980302-191980324 CCCTGGAAGGTGTGAAGGGCAGG + Intronic
943903232 2:193468292-193468314 CTCAGGAAGTTAGGAATGGAGGG + Intergenic
945138508 2:206657219-206657241 CTCAGGAAGCTGAGGAGGGAGGG - Intronic
945843609 2:214917018-214917040 CTCTGGCAGCTATGGAGGACAGG - Intergenic
946243973 2:218374996-218375018 CTCTGGAGGCTGTGGTGGGAGGG - Intergenic
946331680 2:219013141-219013163 CTCTGGAAGCATTGAGGGGCTGG - Intronic
946364829 2:219242629-219242651 GTGGGGAAGCTAGGAAGGGAAGG + Intronic
947950342 2:234141740-234141762 CTCTGGAAGCTGGAAAGGCAGGG - Intergenic
948185461 2:236018211-236018233 CTCAGGAACCTGTGAATGGAAGG + Intronic
948356343 2:237380909-237380931 CTCTGGAACCCCTGAAGGTATGG - Exonic
948398066 2:237662083-237662105 TTCTGGAGGCTCTGAGGGGAAGG + Intronic
1169267670 20:4176572-4176594 CCCTGGGAGCTAGGTAGGGATGG + Intronic
1170516521 20:17135909-17135931 TTCTGGAAGGTTTGAAGGAAAGG - Intergenic
1170662946 20:18360520-18360542 CTCCGGCAGCTCTGAAAGGATGG + Intergenic
1171365558 20:24620662-24620684 CTCTGGAAGATTATAAGGGATGG + Intronic
1172187153 20:33038101-33038123 ATGTGGATGATATGAAGGGATGG - Intronic
1174159883 20:48543193-48543215 CTCAGGAAGCAAAGAAAGGAGGG + Intergenic
1175031239 20:55956407-55956429 CTCTGGAAGCCATGTAAGAAAGG - Intergenic
1179494152 21:41761082-41761104 CTCTGGGACCCATCAAGGGATGG + Intronic
1181437160 22:22917726-22917748 CACTGGAGGTTATGATGGGATGG - Intergenic
1182013082 22:27016758-27016780 CGCTGGAAGCTATGAACCAATGG + Intergenic
1183793340 22:40092757-40092779 CTCTGGAAGCTAAGGCGAGAGGG - Intronic
1184515620 22:44960267-44960289 CTCAGGTAGCTGTGGAGGGAAGG - Intronic
949833317 3:8240516-8240538 CTCTGGCAGCTATGAGGCTATGG - Intergenic
950099976 3:10350630-10350652 CTCTGGAATCCATGAAGGCAGGG - Intronic
950440142 3:13005734-13005756 CTCTGGAGGCTTCGTAGGGACGG + Intronic
951621599 3:24607972-24607994 CTCTGGAAACTTTTAAGAGAAGG - Intergenic
952176188 3:30865916-30865938 TTTTGGAAGCTATGGAGGGGAGG - Intronic
952483195 3:33783373-33783395 CTCTGGCAGCGAGGAAGGTAAGG + Intergenic
952655237 3:35778206-35778228 TTCTGTAATCTTTGAAGGGAAGG + Intronic
953266184 3:41390957-41390979 TTCTAGAGGCTGTGAAGGGAAGG - Intronic
953340174 3:42127458-42127480 CTCAGGAAGCTAAGGTGGGAGGG - Intronic
954543783 3:51415693-51415715 CTCAGGAAGCTGAGACGGGAGGG - Intronic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
955791489 3:62592876-62592898 CTCTGGCAGCTTTGAAGGGGAGG - Intronic
955826893 3:62957097-62957119 CTCAGGAAGCTGAGATGGGAGGG - Intergenic
956775467 3:72561768-72561790 CTTTGGAAGCTGTGAAAGGCAGG - Intergenic
956775528 3:72562280-72562302 CTTTGGAAGCTATGAAAGGCAGG + Intergenic
956775695 3:72563609-72563631 CTCCGGAAGCTGTGAAAGGCAGG - Intergenic
957553483 3:81736191-81736213 CTCTGGAATCTCAGAAGGGTTGG + Intronic
959150867 3:102605990-102606012 CTCTGGAAGCTACTATTGGATGG - Intergenic
959655973 3:108805603-108805625 TTCTGGAGGCTATGTGGGGAAGG + Intergenic
959821658 3:110742078-110742100 CTCTGCAAACTATGAAGAGGTGG - Intergenic
960995975 3:123340542-123340564 CTGTGGGAGATAAGAAGGGAGGG - Intronic
961524334 3:127486962-127486984 CTTTGGAAGCGATCAAGGTAAGG - Intergenic
961535686 3:127569137-127569159 CTAAGGAAGCTATGAAGGGGAGG + Intergenic
963075677 3:141344297-141344319 CTCTAGAAGCTGGGAAGGGTAGG - Intronic
964317896 3:155463579-155463601 TTCTGGAATCTATGAAGTGGGGG + Intronic
966131211 3:176642272-176642294 CACTGGAAGCTATGTGGGGGTGG - Intergenic
967173793 3:186844649-186844671 CTCAGGAGGCTAAGATGGGAGGG - Intronic
967441030 3:189509237-189509259 CTCTGTAAGTTATGCTGGGATGG + Intergenic
968060062 3:195721067-195721089 CTCTGGGAGCTCTGCAGGTAAGG + Exonic
968802578 4:2752955-2752977 CTCGGGAGGCTGTGATGGGAGGG + Intronic
970300433 4:14675795-14675817 CTATGGAAGCTCTGAGGGGCAGG - Intergenic
970990217 4:22204318-22204340 TTGTGGAAGCTATAAAGGCAAGG + Intergenic
971031446 4:22641778-22641800 GTGTGCAAGCAATGAAGGGAAGG - Intergenic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
971383328 4:26119859-26119881 ATCTATAAGCTATGAAGGAAAGG - Intergenic
971524070 4:27593557-27593579 CTCTGGAAGCAATGTATGAAGGG + Intergenic
971695820 4:29901583-29901605 CTCTAGAAGCTGTAAAGGGCAGG + Intergenic
972218404 4:36923341-36923363 CTCTGGAAGATATTATGGCATGG + Intergenic
972822954 4:42723360-42723382 CTCCAGAAGCTAAGAAGAGAAGG - Intergenic
973165086 4:47067358-47067380 CCTTTGAAGCTGTGAAGGGAAGG + Intronic
973780362 4:54283131-54283153 CTCGTGAAGCTACGAGGGGAGGG - Intronic
976798017 4:88956732-88956754 CTCTAGAAGCTAGAAAGTGAGGG - Intronic
977098971 4:92783776-92783798 CTATGGAGGCTGAGAAGGGAGGG + Intronic
977285500 4:95101193-95101215 TTCTGGAAGCCATGTGGGGAAGG + Intronic
978594040 4:110357356-110357378 CTCAGGAAGCTGAGACGGGAGGG + Intergenic
983046196 4:162989368-162989390 TGCTGGAACATATGAAGGGAAGG - Intergenic
984914201 4:184706259-184706281 CTCTGGAGGCTGAGATGGGAGGG + Intronic
985136753 4:186793902-186793924 CTCTGGAAGCTAAGACTCGAGGG + Intergenic
985836231 5:2274080-2274102 CTCTGGAGGCTGAGGAGGGAGGG - Intergenic
986134343 5:4960178-4960200 CTCTGGCAGCTAACAAGGGAAGG - Intergenic
986573428 5:9188862-9188884 CTCTAGAAGCTTTTCAGGGAAGG - Intronic
987338422 5:16917904-16917926 GCCTGGAAGTTATCAAGGGATGG - Intronic
989381407 5:40813056-40813078 CTCTGGAGGCTGAGATGGGAGGG - Intergenic
989714836 5:44450740-44450762 CTAGGGAAGCTATGAGGGGCAGG + Intergenic
990544628 5:56810660-56810682 CTCAGGAAGCTGAGATGGGACGG - Intergenic
990638822 5:57759936-57759958 CTCCGGAGGCTGTGAAGAGAAGG + Intergenic
991256276 5:64618542-64618564 CTCTAGAAGCTATAAAGGAAAGG - Intergenic
991636166 5:68708069-68708091 CTCTGGCAGCTAGGATGGAAAGG + Intergenic
992045948 5:72889404-72889426 ATCTGGAAGATATTAAGGGAGGG + Intronic
992654854 5:78898756-78898778 CTCTAGAAGCTAGAAAGGCAAGG - Intronic
992804044 5:80319614-80319636 CTCTAGGTGCTATGAAAGGATGG + Intronic
993067163 5:83114186-83114208 CTCTGGAGCCTATAATGGGAGGG + Intronic
994354868 5:98783462-98783484 CTCTGGAGCCTGTGAAGGGTGGG - Intronic
995614140 5:113942115-113942137 CCCTGGCAGAGATGAAGGGAAGG + Intergenic
999404601 5:151296041-151296063 ATCTGGATTCTATGAAGGCAAGG - Intronic
1002960563 6:1910928-1910950 CTCTGGAAGCTCTGGAGACAGGG + Intronic
1004264415 6:14136529-14136551 CTTTGGAAACCAAGAAGGGAAGG - Exonic
1012871968 6:104683293-104683315 CTCTGGGGACAATGAAGGGAGGG + Intergenic
1012969444 6:105711964-105711986 CTCTGGAGGAAATGAAGGGAAGG - Intergenic
1013167153 6:107604626-107604648 CTTTGGAAGCTAAGAAGGTGAGG + Intronic
1015376148 6:132512857-132512879 CTCGGGAGGCTAGGAAGGGCGGG - Intronic
1015417601 6:132967575-132967597 CACTGGAAGCCCTGAAGGCAAGG - Intergenic
1016554119 6:145316130-145316152 CTCTGGCAGGGATGAGGGGAGGG - Intergenic
1018598671 6:165514507-165514529 CACTGGGAGCTGTGAAGAGATGG + Intronic
1019449710 7:1091083-1091105 CCCAGGAAGCAATGAAGGTATGG - Intronic
1020139731 7:5605797-5605819 CTCTGGAAGCGGCTAAGGGACGG + Exonic
1022911479 7:34902992-34903014 CTCTGGAAGCAAAGAAAGGCAGG + Intergenic
1025611701 7:63080466-63080488 CTGTGGAAGGTTTGAAGTGAGGG + Intergenic
1026183258 7:68060909-68060931 CTCTGGAAGCTTTGGAGGGATGG + Intergenic
1026299533 7:69085063-69085085 CACTGGAACCTATCAGGGGATGG + Intergenic
1027544777 7:79513668-79513690 CTCAGGCAGATAAGAAGGGATGG + Intergenic
1027855391 7:83504770-83504792 CTCTGGAAGCTATGAAGGGAGGG + Intronic
1030787970 7:113685482-113685504 CTCTGGGAGCTGAGAAAGGAGGG - Intergenic
1033825760 7:145187118-145187140 CCCTGGAAGGAAGGAAGGGAAGG - Intergenic
1034953609 7:155317861-155317883 CTCATGTAGCTATGAAGGGATGG - Intergenic
1035829059 8:2675065-2675087 CTCTGGAAGCTGTGAGGGAATGG - Intergenic
1036516626 8:9450364-9450386 CACTGAAAGCTATGAAGGCAGGG + Intergenic
1037319316 8:17629023-17629045 CTCAGGAGGCTAAGGAGGGAGGG - Intronic
1038286658 8:26211480-26211502 CTGTGCAAGCTAAGAAGGAAGGG - Intergenic
1038363078 8:26902362-26902384 CTTAGGAAGCCATGCAGGGATGG - Intergenic
1038569528 8:28648624-28648646 CTCTGGAAGGGAGGGAGGGAGGG - Intronic
1041496267 8:58488423-58488445 CTCTTGAGGATATGATGGGATGG + Intergenic
1041532079 8:58880348-58880370 CTCTCACAGCTCTGAAGGGATGG - Intronic
1041657802 8:60371156-60371178 CTCTGGAAGCTGGGAAGGCAAGG + Intergenic
1041760150 8:61357587-61357609 CTCTTGAACCTAGGAGGGGAAGG - Intronic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1046981851 8:120345181-120345203 CTCTGGATGATATTAAGGGCTGG - Intronic
1048028285 8:130606860-130606882 TTCTTTAAGCTCTGAAGGGAAGG - Intergenic
1049023230 8:139971542-139971564 CTCTGCAAGGTATGAAGGCAGGG - Intronic
1049656859 8:143802825-143802847 CTCTGGAGTCCAGGAAGGGACGG + Intronic
1050038780 9:1465514-1465536 CTCTAGCTGCTCTGAAGGGAGGG + Intergenic
1051139990 9:13968273-13968295 CTCTGAAAGCTAAGAAGAGGAGG - Intergenic
1052095868 9:24383412-24383434 GTCTGGAGGCTAAGGAGGGAGGG - Intergenic
1053125381 9:35576632-35576654 CTGTGGAAGAGAGGAAGGGAAGG - Intergenic
1054459749 9:65456267-65456289 CTCTGTGAGCTATGAAGTGCTGG + Intergenic
1057757605 9:97850272-97850294 ATCTGGAAGTTAGGAAGGGCAGG - Intergenic
1058007867 9:99938782-99938804 GTCTGGAAGGAAGGAAGGGAGGG + Intronic
1058070335 9:100595254-100595276 CTCTGGAATCTCTGAAAGCAAGG - Intergenic
1058646084 9:107132651-107132673 CTCTGGATGCTCTGTAGGGCGGG + Intergenic
1059526252 9:114993336-114993358 CTCAGGAAGCCATGCAGGGAAGG + Intergenic
1060907043 9:127316049-127316071 CTCTGGAAGCTACAAAAGGGAGG + Intronic
1061051979 9:128202276-128202298 CGGTGGAGGCTAGGAAGGGAAGG - Intronic
1061060296 9:128246812-128246834 CTATGGAAGGGAGGAAGGGACGG - Intronic
1186026921 X:5323533-5323555 CTCAGGAAGCTAAGATGAGAGGG + Intergenic
1186719210 X:12284762-12284784 TTCTGGAAGCTAGGAAGGATAGG - Intronic
1187625569 X:21109192-21109214 GTCTGTAAGATAAGAAGGGAAGG + Intergenic
1188561558 X:31474065-31474087 CTATGGAAGCTATGTTTGGAAGG + Intronic
1189200332 X:39189968-39189990 ATCTGGTATCTATGAATGGAAGG - Intergenic
1189569681 X:42283117-42283139 CTCTGAAAGACAGGAAGGGAGGG + Intergenic
1189637580 X:43027877-43027899 CTCTGGAAGCTGTGGAGGGAAGG + Intergenic
1192539431 X:71955692-71955714 CTCTGGGAGCTGTGAGAGGAGGG + Intergenic
1194022645 X:88712022-88712044 CTCTGGAACCTGTGAGAGGAAGG + Intergenic
1195463940 X:105158965-105158987 CACTGGATGCTGTGAAGAGAGGG - Intronic
1196895471 X:120331571-120331593 CTCAGGAGGCTAAGACGGGAGGG - Intergenic
1198325996 X:135573620-135573642 CTCTGGCAGCCATGGAGGGGAGG - Intronic
1198432782 X:136584506-136584528 CTCTGTAAGGCCTGAAGGGAAGG - Intergenic
1198491701 X:137147575-137147597 CTCTGGCAGCCATGGAGGGAAGG - Intergenic
1200214490 X:154361571-154361593 CTGTGGAAACGATGAAAGGAAGG + Intronic
1200245986 X:154525959-154525981 CTCAGGAAGCTGAGATGGGAGGG - Intergenic