ID: 1027856780

View in Genome Browser
Species Human (GRCh38)
Location 7:83521770-83521792
Sequence CCTTATATGAAGAGACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 9, 3: 48, 4: 286}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027856780_1027856784 -6 Left 1027856780 7:83521770-83521792 CCCTCCTGTCTCTTCATATAAGG 0: 1
1: 0
2: 9
3: 48
4: 286
Right 1027856784 7:83521787-83521809 ATAAGGACACTAATCCTATGAGG 0: 1
1: 5
2: 21
3: 79
4: 261
1027856780_1027856785 -5 Left 1027856780 7:83521770-83521792 CCCTCCTGTCTCTTCATATAAGG 0: 1
1: 0
2: 9
3: 48
4: 286
Right 1027856785 7:83521788-83521810 TAAGGACACTAATCCTATGAGGG 0: 1
1: 11
2: 78
3: 158
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027856780 Original CRISPR CCTTATATGAAGAGACAGGA GGG (reversed) Intronic
900893072 1:5463604-5463626 CCTTGTAAGAAGAGCCAGGAGGG + Intergenic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
902771119 1:18646249-18646271 CCTAATTTGAAGAGAGAGGGAGG - Intronic
904197060 1:28793840-28793862 CCTTAAAGGAAGAGATAGTATGG + Intergenic
904203588 1:28837814-28837836 CCTTACATGAAGAGAGAGTTGGG - Intronic
904213909 1:28904595-28904617 CCTTATAAGAAGAGACACCAAGG + Intronic
904273987 1:29368503-29368525 CCTTATAAGAAGAGACTCCAGGG - Intergenic
905502523 1:38450955-38450977 CCTTATATGAAAAGACACAGAGG - Intergenic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908568329 1:65381991-65382013 TGTAATATGAAGAAACAGGAAGG + Intronic
908633564 1:66137175-66137197 GCTTATTTGAAGAGCCAGGAAGG + Intronic
908878142 1:68700935-68700957 CCTTATAAGAAGAGAAAGTTTGG - Intergenic
909408557 1:75321486-75321508 CCTTGTAAGAAGAGACAATAGGG - Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
913092408 1:115486511-115486533 CCTTAGAAGAAGAGACACTAGGG - Intergenic
914171039 1:145223600-145223622 CATTATATAAAAAGACAGAATGG - Intergenic
914296310 1:146328725-146328747 CATTATATAAAAAGACAGAATGG - Intergenic
914526152 1:148467568-148467590 CATTATATAAAAAGACAGAATGG - Intergenic
914640252 1:149599556-149599578 CATTATATAAAAAGACAGAATGG + Intergenic
916411064 1:164547614-164547636 TCATAGATGAAGAGAAAGGAAGG + Intergenic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
919115731 1:193278209-193278231 CTTTATGTGCAAAGACAGGAAGG + Intergenic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921177699 1:212608473-212608495 CCTGATATGGAGAGAGAGGGCGG + Intronic
921193105 1:212726931-212726953 CCCACCATGAAGAGACAGGACGG - Intronic
921465564 1:215483038-215483060 CTTGATATAAAAAGACAGGAGGG - Intergenic
923463058 1:234223970-234223992 TCTTATAAGAAGAGACATCAGGG - Intronic
923681160 1:236119798-236119820 CCATGTATGCAGAGACAGGGAGG - Intergenic
923738351 1:236633311-236633333 CCTTATAAGAAAAGACATCAGGG - Intergenic
923992961 1:239459649-239459671 CCTTTTTTGGAGTGACAGGATGG + Intronic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
924829745 1:247580603-247580625 CCTTATTTGAAGATTCAGTATGG + Intergenic
1063825770 10:9896266-9896288 CTTTACATGAAGAGGCAGAAGGG + Intergenic
1064239330 10:13611396-13611418 CCTTTTATGAAAAGTCAAGAGGG - Intronic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1064583788 10:16819307-16819329 CCTTAGAAGAAGAGACACCAAGG - Intergenic
1065396345 10:25242598-25242620 CATTATCTGAAGAGAGAGAATGG - Intronic
1065856570 10:29835832-29835854 CCTTAGATGAAGAGAGAATAAGG + Intergenic
1066117089 10:32250116-32250138 CCTTATAAGAAGAGACACAGAGG + Intergenic
1067030837 10:42878144-42878166 TATCATGTGAAGAGACAGGAAGG - Intergenic
1067128414 10:43540085-43540107 CCTTATAGGGAGAGACATCAGGG - Intergenic
1068337707 10:55659065-55659087 TCTTATTTGAAGGGAGAGGAGGG - Intergenic
1069366155 10:67695999-67696021 CTTTATAGGAAGAAACAGAAAGG - Exonic
1069577020 10:69538048-69538070 CCTTATAAGAAGAGACTCCAGGG - Intergenic
1073148253 10:101294414-101294436 GCTTGAATGAAGAGGCAGGAGGG + Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1076032669 10:127172765-127172787 CCTTAAATCAAGACAAAGGATGG - Intronic
1076191786 10:128488308-128488330 CCTTAAAAGAAGAGACACCAGGG - Intergenic
1076493008 10:130876470-130876492 CCTCATAAGAAGAGACAGCCAGG - Intergenic
1078467139 11:11558754-11558776 CCCAAGATGAAGAGGCAGGAAGG - Intronic
1078635997 11:13050868-13050890 CATTTTTTGAAGAGAGAGGAAGG - Intergenic
1079162884 11:18011339-18011361 CCTTAAAAGAAGAGACACCACGG + Intronic
1079615582 11:22488626-22488648 CCTCATAAGAAGAGACATGAGGG + Intergenic
1079870303 11:25790481-25790503 CCTTTAATGAAGCAACAGGATGG + Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1081010818 11:37810901-37810923 CCTTATAAAAAGAGACACCAGGG - Intergenic
1081196638 11:40168919-40168941 CCTTATAAGAGGAAACATGAAGG - Intronic
1081584941 11:44377718-44377740 CCTTATAAGAAGAGACACCAGGG + Intergenic
1081792063 11:45795243-45795265 CCTTTTGTGATGAGACATGAAGG - Intergenic
1082651081 11:55794462-55794484 CACTGTCTGAAGAGACAGGAGGG + Intergenic
1085267446 11:75245639-75245661 CCTTGAAGGAAGAGTCAGGAAGG + Intergenic
1086284901 11:85236463-85236485 CCTTATAAGAAGATACACCAGGG - Intronic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1089586274 11:119511869-119511891 CATTATTTAAAGAGAAAGGAGGG + Intergenic
1089602576 11:119624532-119624554 CCTTTGATGAGGAGGCAGGAGGG - Intronic
1090751347 11:129748966-129748988 TCATCTATGAAGAGGCAGGAAGG - Intergenic
1091576401 12:1740451-1740473 CCTTGTAAGAAGAGACACCAGGG - Intronic
1092785207 12:12020196-12020218 CAATAAATAAAGAGACAGGATGG - Intergenic
1093247552 12:16758776-16758798 CCCTATATTAAAACACAGGATGG + Intergenic
1093540653 12:20280276-20280298 CCTTATATGAAGAGAAAATTTGG - Intergenic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1095283035 12:40379081-40379103 CCTTATAAGAAGAGAAAGTCTGG - Intergenic
1096091610 12:48905670-48905692 CCTTAGAAGAAAAGATAGGATGG - Intronic
1097249205 12:57623150-57623172 CCTTGGATGAGGAGAAAGGATGG + Intronic
1097504790 12:60452399-60452421 GGTTATATGAAGATCCAGGAAGG - Intergenic
1098338883 12:69431551-69431573 GCCCATATGAAGACACAGGATGG + Intergenic
1098465934 12:70785103-70785125 CATAATGTGAAGGGACAGGATGG - Intronic
1098602608 12:72350133-72350155 GAATATATGCAGAGACAGGATGG - Intronic
1099374943 12:81887828-81887850 CATTATAAGAAAAGACAGGTCGG + Intergenic
1099772975 12:87086843-87086865 CATTTTAAGAAGAAACAGGAAGG + Intergenic
1100274579 12:93060448-93060470 CCTTATATGAGGTCATAGGAGGG + Intergenic
1100408707 12:94293918-94293940 CCTTATAAGAAGAGACACCAGGG - Intronic
1100434062 12:94555484-94555506 CCTTATAAGAAGAGAGGGCATGG - Intergenic
1100928445 12:99577859-99577881 CCTTATAGGATGAGATAGGAAGG - Intronic
1101122122 12:101593130-101593152 CCTTATATGAAAAGTCAGCTTGG + Intronic
1101579044 12:106025285-106025307 TCTTATATGAAGAGACACCAGGG + Intergenic
1102603239 12:114049270-114049292 CTTTATATGCAGAGCAAGGAAGG - Intergenic
1104439768 12:128785266-128785288 CCTTATGAGAAGGGATAGGAAGG + Intergenic
1104508015 12:129350827-129350849 CCTCCTATAAAGAGACAAGAAGG + Intronic
1104705292 12:130940830-130940852 CCTTACAAGAAGAGACATGAGGG - Intergenic
1104933789 12:132353950-132353972 CATCATCTGGAGAGACAGGAAGG + Intergenic
1105650974 13:22377711-22377733 TCTTAAACGAAGATACAGGAGGG + Intergenic
1106369033 13:29113438-29113460 GCTGATCTAAAGAGACAGGAGGG - Intronic
1107790586 13:43998334-43998356 CCTTATTTGAAGAGATAAAAAGG - Intergenic
1108724153 13:53162545-53162567 TCTCAGAGGAAGAGACAGGAGGG + Intergenic
1109242786 13:59910867-59910889 GCGTTTATGAAGAGATAGGAAGG + Intronic
1110420186 13:75298839-75298861 TCTTACATGAAGATAAAGGAGGG + Intronic
1111946430 13:94670220-94670242 CTTTATATAAAGAGACCTGAGGG - Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1114232225 14:20793474-20793496 CCTGATAAAAAGAGACATGAGGG - Intergenic
1115128368 14:30023594-30023616 CCTTATGGGAAAAGAAAGGATGG - Intronic
1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG + Intronic
1115461878 14:33670267-33670289 TCTTATTTGATGACACAGGAAGG + Intronic
1116289265 14:43011305-43011327 CCTTACAAGAAGAGACAGCAGGG - Intergenic
1117066066 14:52014281-52014303 CTTTACATGCAGAGACAGCAGGG + Exonic
1118702897 14:68451523-68451545 GCTTAAAGGAAAAGACAGGAAGG + Intronic
1121280013 14:92691360-92691382 CCTTATAAGAAGAGACACCAGGG - Intergenic
1122665257 14:103325401-103325423 CCTTATAAGAAGAGACACAGAGG + Intergenic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1126126768 15:45301098-45301120 CATTATATTAAGAGATAGGAAGG - Intergenic
1127548930 15:60017733-60017755 GCTAATATGCAGAGACAGCAAGG + Intronic
1127759613 15:62125675-62125697 CCTTAAAAGAAGTGACTGGAAGG - Intergenic
1129102471 15:73278976-73278998 CCACATGTGAAGAGACAGTAAGG - Intronic
1130329808 15:82913186-82913208 CCTTGTATGAAGTGCCACGATGG + Intronic
1131751371 15:95511361-95511383 CCTTATAAGAAAAGACCAGAGGG + Intergenic
1132034995 15:98475111-98475133 ACTTATAGGAAGAGAGGGGAAGG + Intronic
1132345840 15:101108265-101108287 CCTTATCAGAAGAGACACCAGGG + Intergenic
1133044692 16:3081257-3081279 CCTTATGTGAAGCGAAGGGACGG + Intronic
1133426366 16:5693775-5693797 ACTTATAAGAAGGGAGAGGAAGG - Intergenic
1134062082 16:11205398-11205420 CATTATATGAAGAGACAATGTGG - Intergenic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1135947291 16:26876399-26876421 CCCTAAATGGAGACACAGGAAGG + Intergenic
1136014431 16:27386303-27386325 CCTTATAAGAAGAGACACCAGGG - Intergenic
1137819951 16:51434830-51434852 CCCGATAGGAAGAGACAGGCTGG - Intergenic
1138072878 16:54010450-54010472 ACTAATATGAAGAGTTAGGATGG - Intronic
1139095224 16:63697061-63697083 CTTTATATAAGGAGACAGAATGG - Intergenic
1140898261 16:79344726-79344748 CCTAATATAAATAAACAGGATGG - Intergenic
1141065601 16:80911284-80911306 CCTTATAAGAAGAGACAGCCGGG + Intergenic
1143188579 17:5024868-5024890 CCCTGAAGGAAGAGACAGGAGGG - Exonic
1143342939 17:6227276-6227298 CCTGATATGATGCAACAGGAAGG + Intergenic
1145732919 17:27206201-27206223 CCTTATAAGAGGGGACAGGGAGG - Intergenic
1146226249 17:31068946-31068968 CCTTATAAGAGGGGGCAGGAGGG + Intergenic
1147522358 17:41186618-41186640 CCTGTTATAAATAGACAGGAAGG - Intergenic
1147858553 17:43501901-43501923 GCTTTTATGAAGAGAGAGAATGG + Intronic
1148343968 17:46891067-46891089 CCTGATGGGGAGAGACAGGAGGG + Intergenic
1148719178 17:49738568-49738590 CCTTAAATGAAGAGACAGCTGGG + Intronic
1148887580 17:50785019-50785041 CCTTACGTGTAGAGACATGAGGG + Intergenic
1149103574 17:52935252-52935274 TGTTATACGAAGAGCCAGGAAGG + Intergenic
1149197568 17:54139627-54139649 CCTGATATGATGCAACAGGAAGG + Intergenic
1150453424 17:65288186-65288208 CCTTATAAGAAGAGACACATGGG + Intergenic
1152287863 17:79422863-79422885 CCTTACAGGAAGAGACAGCAGGG + Intronic
1152475289 17:80513919-80513941 TCTCAAATGAAGGGACAGGATGG - Intergenic
1153415460 18:4841128-4841150 CATTATAAAAAGAGACAAGAAGG - Intergenic
1154204641 18:12326500-12326522 CCTTATATGAATATGCAGTATGG + Exonic
1156552158 18:38028939-38028961 CCTTATACGTGGAGACAGGCAGG + Intergenic
1157394210 18:47328152-47328174 ACTTCTAGGAAGAGAAAGGAAGG + Intergenic
1158079915 18:53577574-53577596 CCATATTTGAAGAGCTAGGAAGG + Intergenic
1158873829 18:61713842-61713864 CCTCCTATAAAGAGACAAGAAGG + Intergenic
1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG + Intergenic
1159223067 18:65490909-65490931 CCTTATAAGAAGAGACACTGAGG - Intergenic
1159320921 18:66846822-66846844 CCTTATAAAAAGAGTTAGGAAGG + Intergenic
1160416096 18:78712086-78712108 CCTTATGAGAACAGACAGGAGGG + Intergenic
1162706866 19:12561597-12561619 CCTTATAAGAAGAGACACCAGGG + Intronic
1165296419 19:34929800-34929822 GCTGAAATGAAGGGACAGGAAGG + Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
1166267279 19:41692039-41692061 CCTCATATGAAGAAACGTGATGG + Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1168474597 19:56666767-56666789 CCTTATAAGAGGAGACACCAGGG + Intronic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
926307764 2:11651498-11651520 CCCTAAATGAAGAAATAGGAGGG - Intergenic
927245888 2:20956919-20956941 CCTTATAAGAAGAGCCAGTTAGG + Intergenic
927369258 2:22335771-22335793 CCTTTTAAGAAGAGACACAAAGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930394608 2:50805300-50805322 ACTTCTATGAAGAAACAGAATGG + Intronic
930549325 2:52811922-52811944 CATCATATTAAGAGAGAGGAGGG - Intergenic
934569849 2:95362404-95362426 CCTTATATGAAGAGTAAGAGAGG - Intronic
934697775 2:96412481-96412503 CCTTGTAAGAAGAGACACCACGG + Intergenic
935227322 2:101064222-101064244 CCTTATAAGAAGAGACACCGGGG + Intronic
940628854 2:156211972-156211994 CCTTATAAGATGAGTTAGGAAGG + Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941982022 2:171468971-171468993 CCTAATAAGAAGAAACAGAAAGG + Exonic
942149597 2:173061988-173062010 CAGGATATGAAGAGAAAGGAAGG - Intergenic
942803145 2:179899080-179899102 CCTTATAAGAAGTGACACCAGGG - Intergenic
943980636 2:194545275-194545297 TCTTATATGATGACAAAGGAGGG - Intergenic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945194170 2:207222940-207222962 ATTTATATGAGGAGACAGAAGGG + Intergenic
946717807 2:222571704-222571726 CCTAATATGCAGGGAAAGGATGG + Exonic
948526256 2:238572667-238572689 CCTCCTAAGAAAAGACAGGAGGG - Intergenic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169410945 20:5369884-5369906 GCTTATCTGCAGTGACAGGAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170102713 20:12720079-12720101 CCTTATAAGAAGTGACACCAGGG + Intergenic
1170105812 20:12753587-12753609 CCTTATATGAGGAGCAAGGAGGG - Intergenic
1170412498 20:16106602-16106624 CCTCCCATGATGAGACAGGAAGG + Intergenic
1171367938 20:24639127-24639149 CCTAAAATGTGGAGACAGGAGGG + Intronic
1172307998 20:33895366-33895388 CCTTAAATGAAGACACAGGGTGG + Intergenic
1172911948 20:38416099-38416121 CCTTATAAGAAGAGACACCAGGG + Intergenic
1174994043 20:55545618-55545640 ACTTCAGTGAAGAGACAGGAGGG - Intergenic
1175354209 20:58349847-58349869 ACACATATGAAGAAACAGGAAGG + Intronic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1177603852 21:23353932-23353954 CATTATAAGATGAGCCAGGAGGG - Intergenic
1178438425 21:32579537-32579559 CCTGATTTGAAGAAACAGGATGG - Intronic
1178596142 21:33954621-33954643 CCTTATAAGAAGAGACACCAGGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1179111722 21:38452662-38452684 CCTTCTAGGATGAGAGAGGAAGG - Intronic
1183011433 22:34950039-34950061 CCTTATAAGAAGAGACACCTGGG + Intergenic
1183716994 22:39539161-39539183 CCTTATACTAAGTGCCAGGAGGG + Intergenic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949569163 3:5275290-5275312 CTTTATAGAAAGATACAGGATGG + Intergenic
950882533 3:16334872-16334894 CCTTATAAGGACAGGCAGGAAGG + Intronic
951513327 3:23528810-23528832 CTAGATATGAACAGACAGGAGGG - Intronic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
955825221 3:62938973-62938995 CCTTATAAGAAGAGACACAGAGG - Intergenic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
957733373 3:84174144-84174166 ATTTATATGAAGATACAGCAGGG + Intergenic
958082675 3:88767147-88767169 CCTGATATAGAAAGACAGGATGG - Intergenic
958470551 3:94512502-94512524 CCTTATAAGAAGAGACACCGAGG + Intergenic
959145842 3:102543473-102543495 CCATATATAAAGAGAGAAGATGG - Intergenic
959372446 3:105544848-105544870 TATTATATAAAGAGACAGTAAGG - Intronic
959608112 3:108264132-108264154 CCTTATAAGAAGAGACACAGAGG + Intergenic
959784189 3:110273839-110273861 CCTTATAAGAAGAGACACCAGGG - Intergenic
960756177 3:121015808-121015830 CCCCATCTGATGAGACAGGAAGG - Intronic
961449192 3:126994853-126994875 CCCTATGTGAACAGGCAGGAGGG - Intronic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
964623585 3:158738587-158738609 CCTTATAAGAAGAGACACAGAGG - Intronic
964719970 3:159761642-159761664 CCTTGCATGAAGAGAAAAGAAGG + Intronic
964825566 3:160823938-160823960 CATAATATCAAGAGACGGGAAGG + Intronic
966535861 3:181032985-181033007 CCTTATAAGAAGAGACTACAGGG - Intergenic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
972084398 4:35196113-35196135 ATTTATATCAAGGGACAGGAAGG + Intergenic
974459985 4:62174833-62174855 CTTTATATGAGGAGATAGCAAGG + Intergenic
974923844 4:68274156-68274178 CCTTATTTTTAGAAACAGGAAGG - Intergenic
976978757 4:91197236-91197258 CCTTATATGGGGAGAAAGCAAGG - Intronic
978265223 4:106815777-106815799 CCTCATAAGAAGAGACACCAGGG + Intergenic
978658001 4:111089118-111089140 CCTTTTTAGATGAGACAGGATGG - Intergenic
978704564 4:111691388-111691410 AAGTATATGAAGAGACAGTAGGG - Intergenic
980098136 4:128514279-128514301 CCTTATAAGAAGAGACACCCGGG + Intergenic
983670747 4:170235109-170235131 CCGTTTATGAAGAGACTAGAAGG + Intergenic
984426273 4:179590928-179590950 CCTTATAAGAAGAGAAAAGGAGG - Intergenic
985787060 5:1901992-1902014 ACTGATAAAAAGAGACAGGAAGG + Intergenic
986467949 5:8045734-8045756 ACCAATATGAAGACACAGGAAGG - Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
989949052 5:50275426-50275448 CCTTCTAACAAGAGACAGGGGGG - Intergenic
989981197 5:50648011-50648033 CATTATATAAAAAGACAGAATGG + Intergenic
992494193 5:77276200-77276222 GCTTATTTTAAGAAACAGGAAGG - Intronic
993168706 5:84387876-84387898 CCTTATAAGAAGAGACACCAAGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994713993 5:103300191-103300213 CCTGATATGATGTGACAAGAAGG - Intergenic
996032798 5:118724872-118724894 CATTAGATGAAAACACAGGAAGG + Intergenic
996347781 5:122505936-122505958 GCTTATCTGAATAGTCAGGAAGG - Intergenic
996556179 5:124781346-124781368 CAGTATATGAAAAGACAGCAAGG + Intergenic
997153268 5:131523072-131523094 GCACATATGACGAGACAGGATGG + Intronic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998674478 5:144391511-144391533 TCTTGAATCAAGAGACAGGATGG + Intronic
1000085018 5:157881202-157881224 ACTTATATGAATAGTGAGGAAGG - Intergenic
1000640401 5:163695756-163695778 AATTATATGAAGCCACAGGAGGG + Intergenic
1000736004 5:164901510-164901532 CCTTAGATGAAGGGATAGCAGGG + Intergenic
1001853136 5:174986876-174986898 CCTGATAAGAAGAGACACCAGGG + Intergenic
1002151790 5:177239618-177239640 TCTTATGGGAAGAGGCAGGATGG - Intronic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1003768869 6:9274471-9274493 CCTCATAAGAAGAGACACCAGGG - Intergenic
1008279884 6:49584361-49584383 CCTTATAAGAAGAGACAATTAGG - Intergenic
1011487706 6:87860174-87860196 CCTTATAATAAGAGACACCAGGG - Intergenic
1012020325 6:93909743-93909765 CATTTTAAGAAGAGACAAGATGG - Intergenic
1012419589 6:99049398-99049420 CCATAGATGAAGAGACTGCAGGG + Intergenic
1012986436 6:105881219-105881241 ACTTATATTAAGAAACCGGAGGG + Intergenic
1014794545 6:125709551-125709573 CTTTATATGAAGACACAGATAGG - Intergenic
1015264143 6:131273198-131273220 TCAAATATGAAGAGACAGGAAGG - Intronic
1016279120 6:142393803-142393825 CCTGAAATAAAGAGACAGAATGG - Intronic
1016973264 6:149785210-149785232 CCTGATATGATGCAACAGGAAGG - Intronic
1017525658 6:155239664-155239686 ACATAGATGAAGAGACAAGAAGG - Intronic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1017774112 6:157667380-157667402 CCTCAAATGAAAAGCCAGGAAGG + Intronic
1017828699 6:158103921-158103943 CCTTAAATGAAGAGATGTGATGG - Intergenic
1018832228 6:167451989-167452011 CTTTTCATGAAGAAACAGGATGG - Intergenic
1019954604 7:4403478-4403500 CCTTATAAGAAGAGACATCAGGG - Intergenic
1022484710 7:30769561-30769583 TCTTATATGTAGAGAGAGAAGGG - Intronic
1023108456 7:36786367-36786389 CCTTCTATGATGGGAGAGGATGG - Intergenic
1023134633 7:37038875-37038897 CCTTATCAGAAGAGACACCAGGG - Intronic
1023568500 7:41548760-41548782 TCTCCTATGGAGAGACAGGAAGG - Intergenic
1023817591 7:43962282-43962304 CCTTGAGTGCAGAGACAGGAAGG - Intergenic
1024342860 7:48284889-48284911 CTTTATATGATGGGAGAGGAGGG - Intronic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1024907167 7:54398755-54398777 CATAATAGGAAGAGAAAGGAGGG - Intergenic
1026082454 7:67234044-67234066 CTTTATAAGAAGAGACATCAGGG + Intronic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1028569195 7:92267441-92267463 CCTTATATGAAGAACCACAATGG - Intronic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029316758 7:99723037-99723059 CCTGAAATGTAGAAACAGGAAGG - Intronic
1029742215 7:102497156-102497178 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029760205 7:102596321-102596343 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1030407942 7:109138490-109138512 CCTTATAGGATGAGTTAGGAAGG + Intergenic
1032642715 7:133787660-133787682 CCCTATGTGAAGACACAGCAAGG - Intronic
1035380699 7:158438808-158438830 CCCTACATGAAAAGACAGGTGGG - Intronic
1035962100 8:4148670-4148692 CCTTACTAGAAGAGACACGAGGG - Intronic
1036583009 8:10094115-10094137 CCCTATTTGAAGGGACAGCATGG + Intronic
1036608687 8:10330993-10331015 CCTTATACGAAGAGACACCAGGG + Intronic
1037396576 8:18449955-18449977 CCTTTTAAGAAGAGACACCAGGG - Intergenic
1039115875 8:34090703-34090725 CTTCCTATGAAGAGACAAGAAGG + Intergenic
1041126781 8:54649406-54649428 CCTTATCTGGAGAGCCAGAAAGG - Intergenic
1041194636 8:55388594-55388616 CCTTATACAAAGAGACATGAGGG - Intronic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041882708 8:62770549-62770571 CCTCATAAGAAGAGACATGAGGG - Intronic
1043550082 8:81361540-81361562 CATCATATGAAGATACAAGAAGG - Intergenic
1044528739 8:93283270-93283292 CCTTATTTGAAAATACAGTAAGG + Intergenic
1044570909 8:93717438-93717460 ACTTACATGAAGTGACAGTAAGG + Intronic
1045216479 8:100154109-100154131 CATTATATGAAAATACAGAAAGG - Intergenic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1046519238 8:115303049-115303071 CCTTATAATAAGAGACACCAGGG + Intergenic
1047864527 8:129007441-129007463 CCTTATATGAACAGGCAGTTAGG - Intergenic
1048439858 8:134451865-134451887 CCTTATATGATGATAGATGAAGG - Intergenic
1051988276 9:23118356-23118378 CTTTATATGAAGACACTTGAGGG + Intergenic
1052264854 9:26560377-26560399 CCTCATCTGAAGAGTCAGAAAGG - Intergenic
1052457384 9:28717707-28717729 ACTAGTAAGAAGAGACAGGAGGG - Intergenic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1056286436 9:85092057-85092079 CCTTATAGGAAAGGACAGGTAGG + Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1056947756 9:91014170-91014192 CATCAGATGCAGAGACAGGAAGG + Intergenic
1057429470 9:94980472-94980494 CATGAAATGAAGGGACAGGAGGG + Intronic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1060169637 9:121450989-121451011 CCTTGTATAAAGAGACTTGAAGG - Intergenic
1061313478 9:129779087-129779109 CCTTATAAAAAGAGACACCAGGG - Intergenic
1061399458 9:130360450-130360472 CCATCCATGAAGAGACAGGTTGG - Intronic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185713316 X:2321533-2321555 CCTTGTAAGAAGAGACACCAGGG + Intronic
1185936258 X:4260786-4260808 CCTTATAAGAAGAGACACAGGGG - Intergenic
1186053048 X:5620524-5620546 GCTTATATTAAGAAACAGTAAGG + Intergenic
1186736584 X:12471757-12471779 CCTGCTATAAAGAGACAGCATGG - Intronic
1188074194 X:25755151-25755173 TCTGATTTGAAGAGACAGGGAGG + Intergenic
1188189104 X:27152409-27152431 CCATATAAGAAGAGACACCAGGG - Intergenic
1189684242 X:43547268-43547290 CATTTTAAGAACAGACAGGATGG - Intergenic
1190243165 X:48673539-48673561 CCTTATAAGAAGAGACGTGATGG - Intergenic
1192886397 X:75339072-75339094 CCTTATATGAAGAGAAAATTTGG - Intergenic
1193013117 X:76699950-76699972 AACTATAAGAAGAGACAGGAAGG + Intergenic
1193793322 X:85842849-85842871 CCTTATAGGAAAGGAGAGGATGG + Intergenic
1194603569 X:95954468-95954490 CCTTACTTCAAGAGACAGCATGG + Intergenic
1196493218 X:116292481-116292503 CCTTCTACAAAGAGACAAGATGG + Intergenic
1201223418 Y:11792680-11792702 CCTTATAAGGAGAGACAGCAAGG + Intergenic
1201720611 Y:17093013-17093035 CCTTATAAGAAGAGACACAGGGG - Intergenic
1202063625 Y:20914252-20914274 CTTTCTATGAAGAGACAAGAAGG + Intergenic
1202264180 Y:23000726-23000748 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202417172 Y:24634468-24634490 CCTTTTATGAAGGCCCAGGAAGG - Intronic
1202453615 Y:25035618-25035640 CCTTTTATGAAGGCCCAGGAAGG + Intronic