ID: 1027856984

View in Genome Browser
Species Human (GRCh38)
Location 7:83524286-83524308
Sequence ATTTATCTGCTGAAGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 494}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027856984_1027856985 5 Left 1027856984 7:83524286-83524308 CCAGTCTTCTTCAGCAGATAAAT 0: 1
1: 0
2: 1
3: 52
4: 494
Right 1027856985 7:83524314-83524336 AAATATTTTTGTAAATAAAAAGG 0: 1
1: 2
2: 43
3: 324
4: 2466
1027856984_1027856987 30 Left 1027856984 7:83524286-83524308 CCAGTCTTCTTCAGCAGATAAAT 0: 1
1: 0
2: 1
3: 52
4: 494
Right 1027856987 7:83524339-83524361 AAACCTGTCTTTACAAGCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027856984 Original CRISPR ATTTATCTGCTGAAGAAGAC TGG (reversed) Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902118554 1:14142034-14142056 ATTTATCTACTGTAGAAGCAAGG + Intergenic
902226706 1:15000722-15000744 GTTTCTCTGCTGAAAAAGGCAGG + Intronic
902933618 1:19748414-19748436 ATTTTTCTGCTCAAGGAGATGGG - Intronic
903133720 1:21295475-21295497 ATTTCTCTGGTGAAAAATACTGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904416539 1:30365262-30365284 ATTTCTCAGCTGTAGAAGTCAGG + Intergenic
905154114 1:35959143-35959165 ATTTTTCTGCTGTATAAGTCAGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907475945 1:54705591-54705613 ATTTATGAGGTGAAGAAGAGTGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909791486 1:79684516-79684538 ATTTATGTACTGAAGAAGTGTGG - Intergenic
910170615 1:84372894-84372916 TTTTTTCTGCTGAAGGAGAAGGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911304099 1:96211866-96211888 ATTGCTCTTCTGAAGAAAACAGG - Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
915541369 1:156568908-156568930 ATTGACTTGCTGAAGAAAACTGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917358705 1:174153968-174153990 ATTTATTTGCTGAAGAAACTTGG + Intergenic
918454911 1:184700225-184700247 ACTTATCAGAAGAAGAAGACAGG + Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919601366 1:199626630-199626652 ATATACCTGCTGTAGATGACGGG + Intergenic
920653999 1:207861516-207861538 ATTTAGCTACTGAGGCAGACTGG + Intergenic
921290043 1:213648922-213648944 GTTTATCTGCTGAGCAAGAGAGG - Intergenic
921995417 1:221412877-221412899 ATTTATCTGTTAAAGAAAAAAGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924451006 1:244179045-244179067 ATTTTTCTGATGAAGAAGAGAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063759954 10:9062540-9062562 ATTTATTTGCTGATGCAGAATGG + Intergenic
1063928151 10:11000960-11000982 ATTTATCAACTGCAGAAGAAGGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064700134 10:18010004-18010026 AGTTATATGATGAAGAAGAGAGG - Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065217253 10:23460959-23460981 ACTTATCTGCATAATAAGACAGG - Intergenic
1065613197 10:27493052-27493074 ATTTATCTGTTGATGGACACAGG + Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068781879 10:60928422-60928444 ATTCATCTGCTGATGGACACAGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068997006 10:63218730-63218752 ATTTATTTGTTGAAGAAACCAGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070495896 10:77022006-77022028 TTTTATATTTTGAAGAAGACGGG - Intronic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074602834 10:114932648-114932670 TTCTCTCTGATGAAGAAGACAGG + Intergenic
1074962639 10:118461913-118461935 ATTTATCTAATGAAGTAGGCTGG + Intergenic
1075044507 10:119135360-119135382 ATTCATCTGCTGAAGGACACTGG - Intronic
1075229621 10:120664349-120664371 ATTTATGTGTTGAAAAACACAGG - Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077623728 11:3751492-3751514 ATTTCACAGCTGAAAAAGACTGG + Intronic
1077648012 11:3943459-3943481 TATTGTCTGGTGAAGAAGACAGG - Intronic
1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG + Intergenic
1078079503 11:8193571-8193593 ATTAGGCTGCTGAAGAAGAAAGG - Intergenic
1078340340 11:10494079-10494101 ATTCATCTGTTGATGAACACCGG - Intronic
1079517606 11:21287652-21287674 ATTCATCTAATGAAGAAGAAAGG - Intronic
1079709064 11:23658165-23658187 ATTTATAGACTGAAGAACACTGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080781627 11:35434937-35434959 ATTTAAATGCAGAAGAAAACTGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083450811 11:62743871-62743893 ATTTATTTGTTGAAGAAGCTGGG - Intergenic
1083555468 11:63622663-63622685 ATTTATCTGCTGTTGCAGATAGG - Intergenic
1083870197 11:65482671-65482693 ATTTATTTGCTGAAGAATCTGGG - Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086186115 11:84018759-84018781 GTTTATCTGCTGAAGAACTCAGG - Intronic
1086587181 11:88466966-88466988 ATTTATCTACTGATGGACACAGG + Intergenic
1087559384 11:99766245-99766267 ATTTATCTGTAGAATAAAACAGG + Intronic
1088034796 11:105298413-105298435 ATCTCTCTGCAGAAGATGACAGG + Intergenic
1088556495 11:111066484-111066506 ATTTATCTGCCTAAGGAGTCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091384940 12:87684-87706 GTTTATATGCTGAAGAAAAAGGG + Intronic
1091459976 12:636981-637003 ATTCATCTGCTGATGGACACTGG - Intronic
1091464353 12:670772-670794 ATTTATTTGTTGAAGAAACCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092440755 12:8499845-8499867 ATTTAACTGCAGAGGAAGAAGGG - Intergenic
1092555994 12:9562232-9562254 ATTTCTTTTCTGAAGAAGACAGG + Intergenic
1092645548 12:10567687-10567709 ATTTATTAGCTGAAGATGAGTGG - Intergenic
1092747740 12:11689483-11689505 TTTTTTCTCCTGGAGAAGACTGG - Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094516101 12:31128416-31128438 ATTTCTTTTCTGAAGAAGACAGG - Intergenic
1095599347 12:43997500-43997522 ATTTCTTTGCTAAAGATGACTGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096602466 12:52739335-52739357 ATTTATTTGTTGAAGAAACCTGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098060869 12:66560933-66560955 ATTCATCTGTTGATGAACACAGG - Intronic
1098078327 12:66757469-66757491 ATTCATCTGCTGATGAACAAAGG + Intronic
1098133615 12:67378111-67378133 ATTTATTTGCTGTAAAAGATAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098760100 12:74412761-74412783 ATTTATGAGGTGAAGAAGTCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100459199 12:94781909-94781931 ATTTATCAGCTGAAAAAAATTGG + Intergenic
1100824803 12:98464551-98464573 ATTTTACTGCTGAGGAAGATGGG + Intergenic
1100833362 12:98540112-98540134 ATTTATTTGGTGAAGAAACCAGG + Intronic
1101213099 12:102554117-102554139 ATTTCTCATCTAAAGAAGACTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104517626 12:129442685-129442707 ATTTATCTGATGAATAATACTGG + Intronic
1107041189 13:35949461-35949483 ATTTATCAGCTGCAGAAGCATGG - Intronic
1107498428 13:40952109-40952131 ATTTATTTGTTGAAGAACTCAGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108494478 13:51010449-51010471 TTATCTCTGCTGAAGAAGATGGG - Intergenic
1108631159 13:52284080-52284102 ATTCATCTGTTGATGAACACAGG + Intergenic
1108655531 13:52528521-52528543 ATTCATCTGTTGATGAACACAGG - Intergenic
1111061757 13:83029463-83029485 ATTTATCTGTTGATGTATACTGG - Intergenic
1111094778 13:83498759-83498781 AATTAACTGCTGAAAAAGAACGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112168776 13:96947993-96948015 ATTTATCTCGTGAAGGAGAAAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112840306 13:103567791-103567813 ATATTTCTGCTGAAGAAGTTGGG + Intergenic
1113499666 13:110763559-110763581 ATTCATCTGTTGATGAACACTGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114959682 14:27870257-27870279 ATGTTTCTGCTGAACAACACAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115362927 14:32523986-32524008 ATTTATCTGTTGAAGAACTTCGG - Intronic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117088864 14:52229264-52229286 ATTTATCTGTTGAGGAACCCAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118117169 14:62792894-62792916 ATTCATCTGCTGATAAATACTGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118235381 14:63998979-63999001 ATTTCTCTAGTGAAGAGGACAGG + Exonic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121687006 14:95843154-95843176 AATTATCTGTTGAAGAAGCCAGG - Intergenic
1122136933 14:99638736-99638758 AATCATTTGCTGAAGAAAACTGG + Intergenic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1124080920 15:26495375-26495397 ATTTATCTGTTGATGAACACAGG + Intergenic
1124453015 15:29815114-29815136 ATTTATCTGTTTAAGAGGAATGG + Intronic
1125988923 15:44086004-44086026 AATTATCTCCTGAATATGACAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129703423 15:77781121-77781143 ATTTCTCTGCTGAGGAGCACAGG + Intronic
1129706014 15:77795025-77795047 ATTTTTCAGATGAAGAAGCCTGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133642775 16:7733943-7733965 ATTTAGCTGCTGAAGGATGCAGG + Intergenic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135751891 16:25065026-25065048 TTTCATCTGCGGAAGCAGACAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138298933 16:55910356-55910378 CTTTATCTGCTGGAGAGGACTGG - Intronic
1138757656 16:59508109-59508131 ATTTATTTGTTGAAGAACCCAGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140145799 16:72307161-72307183 ATTTATCTGTTAAAGAACCCAGG - Intergenic
1141487355 16:84349589-84349611 GTTTATCTGTTGAAGAATCCTGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142730447 17:1851406-1851428 GTTTATTTGCTGAAGAAACCAGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143698954 17:8643094-8643116 ATTTATTGGTTGAAGAAGCCAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149390583 17:56186285-56186307 TTTTATATGCTCAAGAAGGCTGG - Intronic
1149603714 17:57910180-57910202 ATTTCTGTGTTGAAGAACACAGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151273988 17:73020116-73020138 CTTTATGTACTGAAGATGACGGG + Intronic
1152164856 17:78696539-78696561 GTTTATGTGCTGCAGAAGGCAGG - Intronic
1152517379 17:80833637-80833659 ATTTATCTGTTGATTAAAACTGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154017938 18:10636997-10637019 ATTAAACTCCTGAAGAAGAGGGG + Intergenic
1154043587 18:10883160-10883182 ATTTATCTGTTGATGGACACAGG + Intronic
1154186934 18:12192585-12192607 ATTAAACTCCTGAAGAAGAGGGG - Intergenic
1154290278 18:13100800-13100822 AGTTAGCAGATGAAGAAGACAGG + Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156930521 18:42636837-42636859 ATTTGTATAGTGAAGAAGACTGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157335798 18:46736646-46736668 TTTGATCTGCTGAGGAAGAATGG + Intronic
1158414710 18:57239794-57239816 ATTTCTTTGCTGGAGAAGAAAGG + Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1163311345 19:16516766-16516788 GTTTATCTGCTGAAGAGGGCAGG + Intronic
1163534469 19:17869259-17869281 ATTTATCTGCTGGTGAGGTCAGG + Intergenic
1164996841 19:32726832-32726854 ATTTATCTGTTGAGGGACACTGG + Intronic
1166654223 19:44598524-44598546 AGTTATGTACTGAAGATGACAGG - Intergenic
1167572678 19:50299254-50299276 ATTTATCTGTTGAAGAATGTAGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927422705 2:22949716-22949738 ATTAATCTGCTGGAGAGGACAGG + Intergenic
927448919 2:23189579-23189601 ATTGATCTGCTGAAAGAGAGGGG - Intergenic
928092124 2:28381420-28381442 ACTTACCTGCACAAGAAGACAGG - Intergenic
930446589 2:51481344-51481366 AGTTATCTGCCAATGAAGACAGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
930977989 2:57488036-57488058 ATTTATTTGATGCAGAAAACTGG + Intergenic
931089196 2:58867443-58867465 ATTTTTGAGCTGAAGGAGACAGG + Intergenic
932952147 2:76305994-76306016 ATTTATTTGCTGAGAAAGCCAGG - Intergenic
933208924 2:79543386-79543408 ATTAATCTTCTTAAGAAGAAAGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933699924 2:85247589-85247611 ATTCAACTGCTTAAGGAGACTGG - Intronic
934943494 2:98519703-98519725 ATATCTCTGCTGAAGAGGACAGG + Intronic
935387475 2:102515147-102515169 TTTTACCTGCTGAAGACAACAGG - Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935973666 2:108556335-108556357 ATTTATCTGTTGATGGACACGGG + Intronic
936011462 2:108927828-108927850 ATTTGTCAGCTGCAGAAGACAGG - Intronic
936588596 2:113781132-113781154 ATTCATCTGTTGATGGAGACAGG - Intergenic
937266715 2:120620865-120620887 ATTTAGTTGATAAAGAAGACAGG - Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939662663 2:144909577-144909599 ATTTATCTGTTGATGTACACAGG - Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940117430 2:150224464-150224486 AGTTCTTTGGTGAAGAAGACTGG - Intergenic
940633802 2:156272243-156272265 ATTGAACTGATGAAGAAAACAGG + Intergenic
940976907 2:159956544-159956566 ATTTCTGTGCTGAAGAAGGGGGG - Exonic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943041365 2:182809217-182809239 TTTAATCTGGTGAAGAAGACAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943285614 2:185995157-185995179 ATTTACCCTTTGAAGAAGACTGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945110883 2:206358255-206358277 ATTTATCTGTTGATGGACACAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946800104 2:223405594-223405616 ATTTCTCTGATGACCAAGACTGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948851275 2:240707899-240707921 ATTTATCTGTTGAAGAGCAGAGG + Intergenic
1168864069 20:1069666-1069688 ATTCATCTGTTGAAGAACCCAGG + Intergenic
1168919981 20:1524190-1524212 ATTTATTTGCTGAAAAAACCAGG + Intergenic
1169520416 20:6366007-6366029 ATTCATCTGTTGATGAACACAGG + Intergenic
1169816221 20:9659606-9659628 ACTTTCCTGTTGAAGAAGACTGG + Intronic
1171316923 20:24203321-24203343 ATTTGGCTGCTGATGAAAACGGG - Intergenic
1171800958 20:29616597-29616619 TTTTATCTATTGAAGAAGTCTGG - Intergenic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1172856261 20:38005397-38005419 ATTTATATGATAAAGAAGAAGGG - Intronic
1175345488 20:58270371-58270393 ATTTATTTGTTGAGGAAGCCAGG - Intergenic
1176372881 21:6073176-6073198 GTTTATCTGTTGAAGAAACCTGG + Intergenic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176907844 21:14525415-14525437 ATTGATTTGCTGAAGAAGCTGGG - Intronic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177209914 21:18058447-18058469 ATTCATCTGCTGATGAACTCAGG - Intronic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177983502 21:27944852-27944874 ATTTATCTGTTGATGGAAACGGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178036953 21:28595570-28595592 ATTCATCTGTTGATGAACACAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178346848 21:31836329-31836351 ATTCATCTGTTGATGAACACGGG + Intergenic
1179750596 21:43465067-43465089 GTTTATCTGTTGAAGAAACCTGG - Intergenic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181428612 22:22862005-22862027 ATTCATCTGTTGATGAAAACAGG - Intronic
1181840812 22:25658843-25658865 ATTTTTTTGATAAAGAAGACTGG + Intronic
1182661366 22:31927480-31927502 ATTTTTCTTCTGAGGGAGACAGG - Intergenic
1183755775 22:39762804-39762826 ATTAATATGATCAAGAAGACAGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949562644 3:5216647-5216669 AATTATTTGCTTAAGAAGAATGG + Exonic
949673696 3:6428160-6428182 ATTTTTGAGCTGAAGACGACAGG - Intergenic
949845187 3:8362539-8362561 ATTTGTCTGTTGAAGGAGAAGGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951433328 3:22633581-22633603 ATTTAGCTGCTGTGGAAAACTGG - Intergenic
951849928 3:27127916-27127938 ATTTATTTATTGAAGAAAACAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952009533 3:28884560-28884582 ATTTATCTGTTGAAAAACTCAGG - Intergenic
952156017 3:30644356-30644378 GTTTAGCTGGTGAATAAGACAGG - Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952671041 3:35968997-35969019 ATTCATTTGCTGATGAAGACTGG + Intergenic
954008064 3:47609007-47609029 ATTTATGTGTTGAAGAAACCAGG - Intronic
955467839 3:59254816-59254838 TTTGTTCTGCAGAAGAAGACAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958674234 3:97246172-97246194 AATCATCTGCTGAAGCAGAGAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960607653 3:119524342-119524364 AAGTATCTGCTGTAGAATACAGG + Exonic
962191777 3:133318657-133318679 ATTTATTTGCTGAGAAAGACAGG - Intronic
962720769 3:138172755-138172777 ATTTACTTGCTGAAGAAAACAGG - Intronic
962980884 3:140488954-140488976 ATTTATCTGTTGAAGAACACAGG - Intronic
963431069 3:145204394-145204416 ATATATCTGCTGAAAAAGCTAGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963851396 3:150214092-150214114 ATTTATCTGTTGATGGACACAGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965008103 3:163052387-163052409 ATATATATCCTGAAGAAGATTGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966408623 3:179625925-179625947 ATTTATCTGTTGATGGACACAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966779230 3:183569363-183569385 ATTCATCTGCTGATGGACACAGG + Intergenic
967037086 3:185656030-185656052 TTTTCTCTGCTGAACAAGACGGG + Intronic
967752661 3:193132112-193132134 TTTTTTATGCTGCAGAAGACAGG + Intergenic
967806387 3:193717748-193717770 ATTTTTATGCTGAAGATGATGGG + Intergenic
968007963 3:195255846-195255868 ATTTAGCTGCAGAAGAGGTCTGG - Intronic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972027071 4:34394843-34394865 ATTCATCTGTTGATGAACACTGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973811880 4:54579130-54579152 ATTAATCTCATCAAGAAGACTGG - Intergenic
973933201 4:55814501-55814523 ATTTATTTGCTTAAGAAATCTGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975488576 4:74963402-74963424 ATTTATCTGCTGATGTACATGGG - Intronic
975915809 4:79324477-79324499 ATTTATTTGTTGAAGAAACCAGG + Intronic
976639618 4:87324157-87324179 GTTTATCTGTTGATGAACACTGG - Intergenic
976670194 4:87643813-87643835 ATTTATCTGATGAAGAACCTGGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977450850 4:97195130-97195152 ATGGATCAGATGAAGAAGACTGG + Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977717022 4:100194245-100194267 ATTTCTCTGCTTAAAAAGAGAGG - Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978077413 4:104550215-104550237 ATTTATCTGCTGCAGCATAGAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979742030 4:124162963-124162985 ATTGATCTCATGAAGAAGAAAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980502202 4:133671132-133671154 ATTTATCTGATGAATGAGAAGGG - Intergenic
980727161 4:136777478-136777500 AATTGTCTACTGCAGAAGACTGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981428460 4:144632511-144632533 ATTTATTTACTGAAGAAATCAGG - Intergenic
982080667 4:151786647-151786669 ATTTTTGAGCTGAAGAAGACAGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982861183 4:160451183-160451205 AATTATCTGCAGAACAAAACTGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987256461 5:16158368-16158390 ATTCATCTGTTGATGAACACAGG - Intronic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987624002 5:20374126-20374148 ATTTATCAGCAGAATAACACGGG - Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988969550 5:36452742-36452764 ATTTATGTGTTTAAGAGGACAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991155931 5:63435273-63435295 ATTTATCTGTTGGTGAACACAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993348078 5:86810116-86810138 ATGTATCTGTTGACGAACACAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996132548 5:119798957-119798979 ATTTTTCTGCTGATGGAAACTGG + Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997706510 5:135958801-135958823 ATTTATTTGTTGAAGAAACCAGG - Intergenic
997983295 5:138483936-138483958 ATCTATTTGTTGAAGAAAACAGG + Intergenic
997992532 5:138557411-138557433 AGAAATATGCTGAAGAAGACCGG - Exonic
998358275 5:141560231-141560253 ATTTATTTGTTGAAGAAATCAGG + Intronic
999241286 5:150128906-150128928 ATTTATCGAATGAAGAAGAAAGG + Intronic
999833323 5:155341621-155341643 GTTTGTCAGCTGAAGAAGAAAGG + Intergenic
1000059340 5:157639603-157639625 CTTTCTGTTCTGAAGAAGACAGG + Intronic
1000922259 5:167152245-167152267 ATTTACAATCTGAAGAAGACTGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001246866 5:170111403-170111425 AATTTTGTGCTGAAGAAGACTGG - Intergenic
1001850438 5:174959739-174959761 ATTTATCTGTTGATGGACACAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003465741 6:6378219-6378241 ATCTAGCTGCTGAACAAAACAGG + Intergenic
1003577232 6:7308665-7308687 ATATATCTGGTGAAGAATAAGGG - Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006249368 6:32767888-32767910 ATTCATCTGCTGAATGACACAGG - Intergenic
1006998055 6:38281952-38281974 ATTTATTAGCTGGAAAAGACTGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009788379 6:68367413-68367435 ATTTATGTGGAGAAGGAGACGGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010097784 6:72067053-72067075 ATTGCTCTGGTGAAGAAGATGGG - Intronic
1010257854 6:73779617-73779639 ATTTTTCTGCTGATGGACACAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011466854 6:87667206-87667228 ATTTATCTTCTCAACAAAACAGG - Exonic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012461232 6:99463480-99463502 GTTTATTTGCTGAAGAAATCAGG - Intronic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013403562 6:109821848-109821870 ATTTATCTGTTGAAGAATCTGGG - Intronic
1013943934 6:115699640-115699662 TTTTATCTGTTGATGAAAACAGG + Intergenic
1014032772 6:116725176-116725198 ATTCATCTGGTGAAGAAGTGTGG - Intronic
1014140879 6:117940590-117940612 ATTTATCTGTTGCGGAACACAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015127832 6:129773966-129773988 ATTGATCTGTAGGAGAAGACAGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015739730 6:136441085-136441107 ATTCATCTGTTGATGAACACCGG + Intronic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017105604 6:150884831-150884853 ATTTATCTCCTTGAGAAGTCGGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018218422 6:161553177-161553199 ATTTATCTGTTGAAGAAAGCAGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020674666 7:11167667-11167689 GTGTCTCTCCTGAAGAAGACAGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021856708 7:24864257-24864279 ATGTTTCTGCTGAAGAATACAGG + Intronic
1022252164 7:28619161-28619183 ATTTTGCTGCTGAAGAAAGCAGG + Intronic
1022532658 7:31076692-31076714 ATTCATCAGCTGGAGAAGAGGGG - Intronic
1022903693 7:34835182-34835204 ATAGGTCTGCAGAAGAAGACTGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1027671717 7:81107503-81107525 ATTTACCTGCTGAAAAAGAATGG + Intergenic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028530798 7:91836493-91836515 ATCTGTCTACTGAAGTAGACAGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030565621 7:111151409-111151431 ATTTATTTGTTGAAGAAACCAGG - Intronic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1030965339 7:115986421-115986443 ATTGTACTGCTGAGGAAGACAGG - Intronic
1031142406 7:117957715-117957737 ATTTCTCTTCTGAAGAATAATGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033932412 7:146540487-146540509 TTGGATCTTCTGAAGAAGACAGG - Intronic
1036020570 8:4840707-4840729 TTTTATCTTCTGAAGACCACTGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037790919 8:21940980-21941002 ATTTACCTACTGAAGAACTCAGG - Intronic
1038203375 8:25438554-25438576 AATGATCTGCTGAAGCTGACAGG + Intronic
1041397827 8:57409842-57409864 ATTTACCTGCTGAAAGACACTGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043805451 8:84667106-84667128 ATTCATTTGCAGAAGAAAACAGG + Intronic
1044112453 8:88291622-88291644 ATTTTTCTACTCAAGAAGAGAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045799566 8:106086917-106086939 CTTACTCTGCTGAGGAAGACAGG + Intergenic
1047391126 8:124452138-124452160 ATGCACCTGCTGAAGAAGAGTGG - Exonic
1047459756 8:125051561-125051583 ATTCATCTGTTGAAGAACATAGG - Intronic
1048208249 8:132432784-132432806 TTTATTCTGGTGAAGAAGACAGG - Intronic
1050100536 9:2114436-2114458 ACTTGTCTGGTCAAGAAGACGGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052649080 9:31276403-31276425 ATTTATCAGCAGATAAAGACAGG + Intergenic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1054822999 9:69542895-69542917 ATTAATCTTCTGAAGACTACTGG + Intronic
1055515044 9:77024981-77025003 AATTATCTCCTTAAGTAGACTGG + Intergenic
1055810880 9:80146490-80146512 ATTTTTCTCCTGAGAAAGACAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058087003 9:100758667-100758689 ATTTGTCTGCTGATGGACACAGG + Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058624440 9:106919841-106919863 ATATATCTGGGGTAGAAGACAGG + Intronic
1058764756 9:108170982-108171004 ATTCATCTGTTGAAGGACACTGG - Intergenic
1058883916 9:109308428-109308450 ATTTATCTGTTGGAGAAGTGAGG - Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059316762 9:113432212-113432234 ATTTATTTGCTGAAGAAACTGGG + Intergenic
1062078394 9:134604997-134605019 AGATAACTGGTGAAGAAGACAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062295344 9:135822367-135822389 ATGTATCTGCTGAAAACCACAGG + Exonic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1185734384 X:2485941-2485963 ATTTGTTGGCTGAAGAAGAGAGG + Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187001809 X:15188358-15188380 ATTGACCTGCTGAAGAAACCAGG - Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188338021 X:28962154-28962176 ATTTTTCTTCCAAAGAAGACAGG - Intronic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192329513 X:70163842-70163864 AGTTATCTGTTGAAGAAGTTGGG - Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193802744 X:85955801-85955823 ATTTTTCTGTTGATGAACACAGG - Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193877948 X:86885043-86885065 AGTCATCTGTTGATGAAGACAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195483040 X:105370156-105370178 ACTTATCTGCTATAGAAGTCAGG - Intronic
1195555841 X:106222100-106222122 AGGTATCTGGGGAAGAAGACAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199189779 X:144956539-144956561 ATTTATGTGCTGAGGAAAAAAGG - Intergenic
1199840462 X:151641901-151641923 ATTACTCTGCTGGAGAGGACGGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic