ID: 1027857974

View in Genome Browser
Species Human (GRCh38)
Location 7:83537233-83537255
Sequence TAGCTCAAGCTACCACAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027857974 Original CRISPR TAGCTCAAGCTACCACAGAA TGG (reversed) Intronic
902958652 1:19945338-19945360 CAGCTCAAGGTCCCAGAGAAAGG - Intergenic
905082310 1:35334809-35334831 TAGCTCAAGATGACACAAAAAGG - Intronic
906282292 1:44562684-44562706 TAGCTCAAGGAACCTCAAAAAGG + Intronic
908524868 1:64977846-64977868 TTGCTCAAGATCCCACAGTAGGG - Intergenic
911895154 1:103424485-103424507 TAGCCCAAGCTACTGCAAAATGG + Intergenic
918817795 1:189211633-189211655 CAGCTTAAGATATCACAGAATGG - Intergenic
919781347 1:201223069-201223091 TAGCTGAAGCTACCACTAGAGGG - Intronic
920041402 1:203100032-203100054 TGGCCCAAGCCCCCACAGAAAGG - Intronic
1070685430 10:78476929-78476951 CTGCTCAAGCTCCCACATAAGGG - Intergenic
1073646450 10:105309291-105309313 TTGCTCAAGGTAACACAGGATGG + Intergenic
1074789693 10:116874539-116874561 AAGCTCCAGCTAGCACAGCAGGG - Intronic
1080208754 11:29760724-29760746 TAGCTTTTGCTACCACAGTATGG + Intergenic
1080309444 11:30872580-30872602 ATGCTCAAGCTACCAAAGGAAGG - Intronic
1086996088 11:93357929-93357951 TAACTCAAGCTACCATACAGTGG - Intronic
1091823855 12:3494837-3494859 CAGCTCAAGTTAACAGAGAAGGG - Intronic
1092512401 12:9170788-9170810 TACCTGAAGCCCCCACAGAAAGG - Intronic
1096051800 12:48615970-48615992 TGGCTGAAGCTCCCACAGAGAGG + Intergenic
1098517920 12:71399598-71399620 TAACTCAAGCTACCACTTAAAGG + Intronic
1098990513 12:77060414-77060436 TAGTTCATGCTGCCAAAGAAAGG + Intronic
1107664148 13:42671901-42671923 TTGCTCAACCTGCCACAAAAGGG + Intergenic
1121030055 14:90650530-90650552 AAACTCAAGCTAGGACAGAAAGG + Intronic
1127552272 15:60052335-60052357 TCTCTCGAGCTACCATAGAAGGG - Intronic
1130886583 15:88098103-88098125 TAGTTCAAGCTGCTACTGAAAGG + Intronic
1132215636 15:100059726-100059748 CAACCCAAGCTGCCACAGAAGGG - Intronic
1137422925 16:48351439-48351461 TAGCTCATGCTATAACAAAACGG + Intronic
1137904898 16:52311061-52311083 TAGCTCCAGCTCACACAGAAAGG + Intergenic
1148871793 17:50662788-50662810 CAACTTAAGCTATCACAGAAGGG + Intronic
1153391500 18:4566383-4566405 AGGCTCAAGCTCACACAGAAAGG + Intergenic
1154111240 18:11570239-11570261 GAGCTCAAGGCAACACAGAATGG - Intergenic
1155005798 18:21728096-21728118 TAGTTGAAGGTACCAGAGAATGG - Intronic
1155635817 18:27954269-27954291 TAACACAATCTACCACAGAAGGG - Intronic
1161424629 19:4196230-4196252 TAGCTCAAGGTCACACAGCAAGG + Intronic
1165306280 19:35004947-35004969 TAGCTCAGGGTCACACAGAAAGG + Intronic
927968913 2:27291749-27291771 TTGCTGAAGCAATCACAGAAGGG + Intronic
930191015 2:48460043-48460065 TGGCTCAGGCTACGACAGATAGG - Intronic
931083812 2:58806554-58806576 TAGTTTAAGCTACCAAATAATGG - Intergenic
932193500 2:69762443-69762465 AAGCTGATGCTAACACAGAAAGG - Intronic
936526975 2:113247953-113247975 TGGCTCAAGGAAACACAGAAGGG + Intronic
936621852 2:114108360-114108382 TTTCTCAAGCTAACACAGCAGGG + Intergenic
939415593 2:141892918-141892940 TAGCTCAAATTATCACATAATGG - Intronic
944044789 2:195397240-195397262 TAGCACAGGCTAACAGAGAATGG + Intergenic
944345425 2:198659689-198659711 TAGCCCCACCTACCAGAGAAGGG - Intergenic
1173731016 20:45328660-45328682 GAACTCAATCTGCCACAGAAGGG - Intronic
1175526107 20:59634833-59634855 TGGCTCATGCAACCTCAGAATGG + Intronic
1176519120 21:7811835-7811857 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1178653148 21:34441848-34441870 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1183100296 22:35579648-35579670 TTGCTCAAGGTCCCACAGCAAGG + Intergenic
950657224 3:14444076-14444098 CTGCTCAAGGTAACACAGAAAGG - Intronic
953364858 3:42335707-42335729 TAGTTCACACTACCACAGATGGG - Intergenic
957695304 3:83629735-83629757 TTCATCAAGCTACCTCAGAAGGG - Intergenic
959640655 3:108628835-108628857 TAGCTCAAGCTTGAACAGTATGG - Intronic
962669113 3:137686792-137686814 TAGCTCAAGCCAGCACACAGTGG - Intergenic
964743724 3:159992062-159992084 TTGGTCTAGCTACCACAGAAAGG + Intronic
965239314 3:166174303-166174325 TAGCCTAAGCTACCACAAAAGGG - Intergenic
971055877 4:22911709-22911731 TAGCCCAAGCTACCATGGTAGGG + Intergenic
977280351 4:95032077-95032099 TATCACAAGATACCACAGACTGG + Intronic
978419501 4:108515063-108515085 AAGCACCAGCTTCCACAGAATGG - Intergenic
979753826 4:124314258-124314280 TTACTCAAGCTACCACAGTTTGG - Intergenic
980039250 4:127920365-127920387 TAGTTCATGCAACCACAAAAAGG + Exonic
982387527 4:154826770-154826792 AAGCTCAAGCAACATCAGAAAGG - Intronic
982519035 4:156390024-156390046 TACCTCAAGCTGCCTCACAATGG - Intergenic
984531490 4:180921913-180921935 TAGGTCATGCTACCAGTGAAAGG + Intergenic
986228900 5:5843504-5843526 TAGCTCAAGATAGCACTGAATGG - Intergenic
988055331 5:26087167-26087189 AACCTCAAGCTACAAGAGAAGGG + Intergenic
990715797 5:58635029-58635051 TAACTAAAGGTACCACAGTAAGG + Intronic
993014008 5:82515177-82515199 TATTACAAGCTAACACAGAATGG - Intergenic
993363381 5:87004827-87004849 TGGCTCAAGACTCCACAGAATGG + Intergenic
997043270 5:130282281-130282303 TAGACCAAGCCAGCACAGAATGG + Intergenic
997164947 5:131651033-131651055 CAGCCCAAGCTAAGACAGAAGGG - Intronic
997896745 5:137725471-137725493 CAGCTCAAGCTACTACACAAAGG + Intronic
998173404 5:139885656-139885678 AAGCTGAAGTTACCAGAGAAAGG + Intronic
998494617 5:142576974-142576996 TAGCTAAAGGTTCCACAGATAGG - Intergenic
999401715 5:151269378-151269400 AAGCTCAAGCTCCTGCAGAAGGG - Exonic
1001433262 5:171680290-171680312 TAGCTCATGGAACCACAGAAAGG + Intergenic
1003132641 6:3408611-3408633 TGGCTGAAGCTGCCAGAGAATGG - Intronic
1006406924 6:33850872-33850894 TAGCTCAAACTACCGCAGGAAGG - Intergenic
1007114873 6:39336301-39336323 CAGCTCCAGCAACCACAGGAAGG + Exonic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1009446276 6:63746070-63746092 TATCTCAAAATACCACAGACTGG - Intronic
1009451774 6:63809814-63809836 TAGCAAAAGTTATCACAGAAAGG + Intronic
1010830752 6:80525953-80525975 TTTTTGAAGCTACCACAGAATGG + Intergenic
1012406794 6:98909892-98909914 TAGCTAAAGTTGCCACATAAAGG - Intronic
1013272072 6:108554667-108554689 TAGAACAACCTACCACAGCAGGG - Intergenic
1019020122 6:168911368-168911390 TAACTCAAACAACCACAGCAAGG - Intergenic
1019209776 6:170395503-170395525 GGGCTCCAGCTACCACAGGACGG + Exonic
1022323571 7:29309560-29309582 TAGCTCATGCTAAGCCAGAAAGG - Intronic
1024699165 7:51888332-51888354 TAACTTAATCTACTACAGAAAGG - Intergenic
1027857974 7:83537233-83537255 TAGCTCAAGCTACCACAGAATGG - Intronic
1032511128 7:132473217-132473239 TGGCTCAAGCTACCTCTGCATGG + Intronic
1037215720 8:16448839-16448861 TATCACAAAATACCACAGAATGG + Intronic
1038291360 8:26252580-26252602 GAGCTCAGGCTCCTACAGAACGG - Intergenic
1038886525 8:31668855-31668877 TAACTCAGGCTACTACAGATTGG + Intronic
1043341373 8:79243992-79244014 TACTTCAAGCTACCACAGGGAGG - Intergenic
1043942967 8:86216709-86216731 TTGCTCAAGCTCACACAGCATGG - Intronic
1048544916 8:135377779-135377801 TAGCTTAAGTTCCCACAGAAGGG + Intergenic
1048590232 8:135814548-135814570 GAGCTCAATCTACCACACAAGGG + Intergenic
1048633107 8:136266030-136266052 TAGCACCAGATATCACAGAAAGG + Intergenic
1050726409 9:8654186-8654208 TATCTCAAGAAACCACAGGATGG + Intronic
1052821578 9:33141606-33141628 AAGCTAAAACTAGCACAGAAGGG + Intronic
1053476616 9:38386476-38386498 TGGCTCAAGGTCACACAGAAAGG + Intergenic
1058855770 9:109060687-109060709 TACCTCACGCTATCAGAGAATGG + Intronic
1203376010 Un_KI270442v1:378534-378556 GACCTGAAGCTACCACAGCACGG - Intergenic
1187054823 X:15732641-15732663 TAGCTGAAGGAACCACGGAAAGG - Intronic
1187887076 X:23899065-23899087 TATCTCTAGCTCCCACAGAGGGG + Intronic
1189706060 X:43760085-43760107 CAGTTAAACCTACCACAGAAGGG - Intergenic
1192054222 X:67756939-67756961 TAGCCCAAGTTACCACAGCTAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1197602465 X:128546975-128546997 TAATTCAAGATAACACAGAAGGG - Intergenic
1198116427 X:133549305-133549327 TGGTTCCAGCTATCACAGAATGG - Intronic
1202020893 Y:20463650-20463672 CAGCTCAAGATGCAACAGAAGGG - Intergenic