ID: 1027858619

View in Genome Browser
Species Human (GRCh38)
Location 7:83545832-83545854
Sequence ATATATCTCCAGTAGTATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027858618_1027858619 0 Left 1027858618 7:83545809-83545831 CCAGTATTATATATATATATAAT 0: 1
1: 4
2: 37
3: 300
4: 1899
Right 1027858619 7:83545832-83545854 ATATATCTCCAGTAGTATGACGG 0: 1
1: 0
2: 1
3: 8
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027858619 Original CRISPR ATATATCTCCAGTAGTATGA CGG Intronic
903232726 1:21931648-21931670 ATATACCCCAAGTAGTCTGAGGG + Intronic
903678574 1:25082307-25082329 ATACATCCCCAGTACAATGAGGG - Intergenic
907817573 1:57935411-57935433 ATAAATGTCAAGTAGTATTATGG + Intronic
908049668 1:60215223-60215245 TTATACCTCTAGTAGTATGCTGG + Intergenic
909404361 1:75270560-75270582 ATATTTCTCTAGTATTTTGATGG - Intronic
910636355 1:89413086-89413108 ATATATACCCAGTAGTGGGATGG + Intergenic
911051687 1:93676844-93676866 ATCTATTTCCAATAGCATGATGG + Intronic
911169511 1:94756327-94756349 TTACCTCTCCAGTAGTAGGATGG - Intergenic
911373289 1:97020173-97020195 ATATATACCCAGTAGTGGGATGG - Intergenic
911894563 1:103415186-103415208 GTATTTCTCAAGTTGTATGATGG - Intergenic
914376137 1:147075608-147075630 ATAAATCTCCAGTTGTCTGCAGG + Intergenic
914505592 1:148286495-148286517 ATAAATCTCCAGTTGTCTGCAGG + Intergenic
915089357 1:153412619-153412641 GTATATACCCAGTAATATGATGG - Intergenic
915703246 1:157818139-157818161 ATACATGTCCAGTAGTGGGATGG - Intronic
915809480 1:158891602-158891624 ATATATACCCAGTAGTGGGATGG - Intergenic
916642108 1:166741343-166741365 ATTTATTTCCAGTAATAAGATGG - Intergenic
917266497 1:173226296-173226318 ATATCTCTCCAGTGGAATGTGGG + Intergenic
919191338 1:194223880-194223902 ATATATACCCAGTAGTAGAATGG - Intergenic
919409333 1:197224910-197224932 ATATATATCATATAGTATGAAGG + Intergenic
921299081 1:213733151-213733173 ATATATAACAAGTAGTAGGATGG + Intergenic
922629902 1:227095936-227095958 ATATATCTACAGCAATTTGATGG + Intronic
923116144 1:230939752-230939774 ATTTATCTCAAATAGTATTATGG + Intronic
923564551 1:235067240-235067262 AAATATATCCAGTATTTTGAAGG + Intergenic
1065149219 10:22804906-22804928 AAACATCTCCAGTAGTGCGAGGG + Intergenic
1065253803 10:23844402-23844424 CTATATCTTCAGTAGGCTGAAGG - Intronic
1068228329 10:54136052-54136074 AAATATCTACAGTATTATAAAGG - Intronic
1068402570 10:56549185-56549207 GTATATATCCAGTAATAGGATGG + Intergenic
1069039537 10:63680812-63680834 GTATATCTCCAGTGGAATGGAGG + Intergenic
1069170360 10:65220391-65220413 ATATTTCTCCAGAAGAATGTTGG - Intergenic
1070772654 10:79091390-79091412 ATATTTCTCCATTAGAAGGATGG + Intronic
1071605544 10:86984854-86984876 GTATATACCCAGTAGTAGGATGG + Intergenic
1072487146 10:95866354-95866376 ATATCTTTCCAGAAATATGAAGG - Exonic
1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG + Intronic
1076118643 10:127918820-127918842 GTATTTCTCAAGGAGTATGAAGG + Intronic
1081020732 11:37945633-37945655 TTATATCTCCAGTAAAATCAGGG + Intergenic
1082601848 11:55168035-55168057 GTATATGTCCAGTAGTGGGATGG + Intergenic
1082636083 11:55596064-55596086 ATATATATCCAGTAATGGGATGG + Intergenic
1085667411 11:78426970-78426992 AGGTATCTCCAGTAGTATTTGGG + Intergenic
1086132724 11:83418625-83418647 ATATATCTCCTGTACTCTGAAGG + Intergenic
1088135088 11:106546111-106546133 GTATATCACCAGTATCATGAAGG + Intergenic
1088537906 11:110881708-110881730 GTATATATCCAGTAATAGGATGG - Intergenic
1089251029 11:117161856-117161878 ATAGATCTCGGGCAGTATGAGGG + Intronic
1089346284 11:117793803-117793825 ATATTTCTGCAGTAGAATGGGGG - Intronic
1089474865 11:118751207-118751229 ATATGCCTCCAGTAGTAGTATGG - Exonic
1090719954 11:129462755-129462777 ATACATCACCAATAGGATGAAGG - Intergenic
1095604191 12:44046878-44046900 ATGTGTTTCCAGTTGTATGAAGG + Intronic
1096045840 12:48561411-48561433 ATATTTCTCTTGTAGTGTGATGG - Intergenic
1097394760 12:59060282-59060304 TTATTTCTCCTGTAGTATGGAGG + Intergenic
1098775738 12:74613034-74613056 ATATATCTCTGGAAATATGAAGG - Intergenic
1098805394 12:75015787-75015809 ATATATTTCCAGTTGTACGTAGG + Intergenic
1098940343 12:76527458-76527480 ATATATCTCCAATCTTTTGATGG + Intronic
1102320045 12:111925483-111925505 ATATATGTCCATTAGCATAAGGG - Intergenic
1104157472 12:126147730-126147752 ATATCTCTGCAGATGTATGAGGG - Intergenic
1104550464 12:129752077-129752099 AAATCTTCCCAGTAGTATGAGGG - Intronic
1105046025 12:133003876-133003898 ATACATCCCAAGTAGCATGACGG - Intronic
1106061217 13:26294427-26294449 CTATATAGCCAGTAGTAGGATGG + Intronic
1107288244 13:38821517-38821539 TTATTTCTCCAGTAGTATGAAGG - Intronic
1109468387 13:62769878-62769900 ATATATGTAAAGTAGTATCAAGG + Intergenic
1109821046 13:67655105-67655127 ATATATCTCCAGTATGAAGCTGG - Intergenic
1110272882 13:73610735-73610757 ATGTTTTTCCAGTATTATGAAGG + Intergenic
1111000724 13:82176849-82176871 GTAAATATCCAGTAGTAGGATGG - Intergenic
1111184148 13:84708944-84708966 ATATATATTCAGTATTATTAGGG + Intergenic
1116197818 14:41752270-41752292 GTATATATCCAGTAATAGGATGG + Intronic
1116202660 14:41818575-41818597 ATATTTCTTAAGTAGTATGTGGG + Intronic
1116505175 14:45668920-45668942 GTATATACCCAGTAGTAAGATGG + Intergenic
1116595047 14:46830814-46830836 ATAAATGTCCAGGAGTATAATGG - Intergenic
1116647564 14:47548783-47548805 CTAGATCTCCAGAAGTATGGCGG + Intronic
1119605959 14:76017321-76017343 ATATAACACCAATAGAATGAGGG - Intronic
1122755581 14:103976681-103976703 AAATATACCCAGTAGTAGGATGG + Intronic
1202830010 14_GL000009v2_random:17827-17849 ATATATATCCAGTAATGGGATGG + Intergenic
1125215569 15:37269615-37269637 ATAGATCTCCAGTCTTATGCTGG + Intergenic
1126433546 15:48612314-48612336 AGAAAACTCCAGTAGTATAATGG - Intronic
1128400071 15:67269991-67270013 ATATATACCCAGTAGTGGGATGG + Intronic
1128825108 15:70707906-70707928 ATATATACCCAGAAGTAGGATGG - Intronic
1130236364 15:82138240-82138262 AAATATCTCCAGTAATTAGAGGG - Intronic
1130423842 15:83775525-83775547 ATATATCTCCAGAAGGCTGAAGG + Intronic
1132155287 15:99491793-99491815 ATTTAGCGCCAGTATTATGAAGG - Intergenic
1133945840 16:10347510-10347532 GTATATATCCAGCAGTAAGATGG + Intronic
1134288768 16:12886295-12886317 AAATAGCTCCAGTAGTCTCAGGG + Intergenic
1137650700 16:50117742-50117764 ATAAATATCCAGTAGTGGGATGG - Intergenic
1139726038 16:68899308-68899330 ATATATCACAAGCAATATGAAGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143916858 17:10300480-10300502 ATATATGCCCAGTAGTGGGATGG + Intronic
1143979823 17:10859050-10859072 AGATATATCCAGCAGTATCAGGG - Intergenic
1146601782 17:34223551-34223573 ATACATTTCCAGAAGAATGATGG - Intergenic
1149957815 17:61072650-61072672 ATAAAGCTCGAGTAATATGATGG - Intronic
1152973127 18:184944-184966 ATCTAACTCCAGGAGTATGATGG - Intronic
1153379172 18:4416953-4416975 ATATATATTCAGTAGTGTGAGGG + Intronic
1153781406 18:8498122-8498144 GTATATACCCAGTAGTAGGATGG + Intergenic
1154942034 18:21123564-21123586 ATTTATCTCTAGAACTATGAGGG - Intergenic
1156146913 18:34193717-34193739 ATATATACCCAGTAGTAGGATGG - Intronic
1156737537 18:40278819-40278841 ATATATATTCAGTAATAGGAGGG + Intergenic
1158805616 18:60968443-60968465 AAATACCTTCAGTAGCATGAGGG - Intergenic
1159705939 18:71687663-71687685 ATATATATCCAGTAGTGGAACGG - Intergenic
1160294504 18:77624886-77624908 ATATATGTCATGTAGTATGTTGG + Intergenic
1166026293 19:40088632-40088654 ATATATTCCCAGTAGTGGGATGG - Intronic
1166958503 19:46482693-46482715 ATATATGTGCAGCAGAATGATGG - Intronic
1202642679 1_KI270706v1_random:109958-109980 ATATATATCCAGTAATGGGATGG - Intergenic
925494400 2:4430121-4430143 ATATATCTTCAGTAATAGTAAGG - Intergenic
929179037 2:39013182-39013204 ATATATATCCCAAAGTATGAGGG - Intronic
930543968 2:52744130-52744152 ATATGTATCCAGTAGAAAGAAGG + Intergenic
931611244 2:64103420-64103442 ATAAATGTCCTGTAGTATGTGGG + Intronic
932870402 2:75392855-75392877 GTGTATTTCCAGTTGTATGAAGG - Intergenic
934586145 2:95497793-95497815 ATAGAATTCCAGTAGTATGATGG + Intergenic
936786616 2:116100709-116100731 ATATATTTTTAGTAGTATGGTGG - Intergenic
936823931 2:116557403-116557425 GTATATGTCCAGTAATAGGATGG - Intergenic
936877783 2:117213305-117213327 ATAAATCTCTAGTAGGAAGATGG - Intergenic
944423882 2:199558922-199558944 ATTTTTCTCCAGTAGAATAAGGG - Intergenic
946536324 2:220633458-220633480 ATATATCACTAGTAATATGGAGG - Intergenic
946600968 2:221359739-221359761 ATATATGTACAGTGGTATGCAGG + Intergenic
1169576165 20:6964204-6964226 AAATATCTAGAGTAGTTTGAAGG + Intergenic
1169984243 20:11424059-11424081 ACATATCTGCAGCAGTATTATGG + Intergenic
1171516718 20:25744253-25744275 ATATATATCCAATAATTTGAAGG - Intergenic
1171991345 20:31698880-31698902 ATATATCTCCAATAGTGTGGTGG + Intronic
1174957757 20:55118939-55118961 ATATTTCTGCAGTACAATGAGGG + Intergenic
1176609196 21:8862667-8862689 ATATATATCCAGTAATGGGATGG + Intergenic
1177122672 21:17157380-17157402 GTATATATCCAGTAATGTGATGG - Intergenic
1177660691 21:24079165-24079187 GTATATACCCAGTAGTAAGATGG + Intergenic
1178207571 21:30487209-30487231 CTATATCTTCTGTAGCATGATGG + Exonic
1180359291 22:11872498-11872520 ATATATATCCAGTAATGGGATGG + Intergenic
1181832489 22:25572363-25572385 ATATATATCCAGTAATGGGATGG + Intronic
1183240803 22:36656946-36656968 GCCTATCTCCAGTAGAATGAGGG + Intronic
951116722 3:18871759-18871781 AAATTTCTCCAGGAGGATGAGGG + Intergenic
951287227 3:20828028-20828050 ATATATCTTCAGTTATCTGAAGG + Intergenic
956084380 3:65594771-65594793 AAATATCTGCAGTATTCTGATGG + Intronic
957319822 3:78615598-78615620 ATATATCTCCATTGGGATTATGG - Intronic
957672730 3:83326923-83326945 ATATATATCCAGTAATGAGATGG - Intergenic
958597255 3:96242876-96242898 ATATATAACCAGAAGTCTGAGGG - Intergenic
960847474 3:122018027-122018049 ATATATGCCCAGTAGTGGGATGG - Intronic
961701656 3:128749316-128749338 ATATATATTCAGTATAATGAAGG - Intronic
964228419 3:154434087-154434109 GTATATATCCAGTAATAGGATGG + Intergenic
964235696 3:154524321-154524343 ATATATCCCCTGGAGTTTGAGGG - Intergenic
966288430 3:178325338-178325360 ATATATAACCAGTAGAATGTTGG - Intergenic
970747222 4:19313480-19313502 CTCTATTTCCAGTAGCATGATGG + Intergenic
972914339 4:43857323-43857345 ATATATACCCAGTAATGTGATGG + Intergenic
974152146 4:58023782-58023804 GTATATCTCCAGTAATGGGATGG + Intergenic
974278254 4:59755837-59755859 AAATATCACCAGCAGTGTGAGGG + Intergenic
974750435 4:66133650-66133672 GTATATATCCAGTAATAGGATGG - Intergenic
974840606 4:67295355-67295377 GTATATCCCCAGTAATAGGATGG + Intergenic
975062674 4:70022094-70022116 ATATATATCCAGTCATGTGATGG - Intergenic
975093631 4:70432253-70432275 GTATATATCCAGTAGTGGGATGG + Intronic
976498555 4:85759120-85759142 ATATTTTTCCAGCAGTATTAGGG - Intronic
978607839 4:110501794-110501816 ATATATATCCTGTAATAAGATGG + Intronic
981284235 4:142996520-142996542 ATATATATCCAGCAATAGGATGG - Intergenic
981625814 4:146753537-146753559 ATATATATCCAGCAATAGGATGG - Intronic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
1202770048 4_GL000008v2_random:195857-195879 ATATATATCCAGTAATGGGATGG - Intergenic
988215963 5:28273526-28273548 ATATATACCCTGTAGTAGGATGG + Intergenic
989128141 5:38076734-38076756 ATATATCCCCAGTAATGGGATGG - Intergenic
989660960 5:43797250-43797272 ATATATATCCAGTAATGGGATGG - Intergenic
990656892 5:57967089-57967111 ATATATACCCAGTAATAGGATGG + Intergenic
990750961 5:59015759-59015781 ATATATATCCAGTAATGGGATGG - Intronic
991076581 5:62546083-62546105 GTATATCTCCAGTAATGGGACGG - Intronic
991267518 5:64739347-64739369 ATAAACCTCCAGTAGTCTGCTGG + Intronic
991325727 5:65429661-65429683 TTAAATGTTCAGTAGTATGATGG - Intronic
993203683 5:84849765-84849787 GTACATTTCCAGTTGTATGAAGG + Intergenic
995023555 5:107393824-107393846 AGATATTTCCAGTAGTACCATGG - Intronic
996528830 5:124505641-124505663 ATGTATCTCCAGTTGAAAGAAGG - Intergenic
997078052 5:130704563-130704585 GTATATGTCCAGTAGTGGGATGG - Intergenic
997917102 5:137938022-137938044 ATATATGTCCACCAGTATAATGG - Exonic
999732029 5:154482308-154482330 CTGTATCTCCAGTCTTATGATGG - Intergenic
999815710 5:155173963-155173985 GTATATATCCAGTAATAGGATGG - Intergenic
1000761485 5:165230741-165230763 TAATATGTCAAGTAGTATGAGGG + Intergenic
1001754574 5:174158776-174158798 ATTTATCTCCAGTCCTGTGAAGG + Intronic
1003082176 6:3029991-3030013 ATATATCTCCTGTAAACTGAAGG - Intergenic
1005106854 6:22233143-22233165 ATAGATCACCAGTACTTTGAAGG - Intergenic
1005724708 6:28637381-28637403 ATAGATCTTCAGTAATGTGAGGG + Intergenic
1009795525 6:68462054-68462076 GTATATACCCAGTAGTGTGATGG + Intergenic
1009877476 6:69522934-69522956 GTATATACCCAGTAGTAGGATGG - Intergenic
1010067311 6:71698853-71698875 ATATGTATCCAGTTGTATTATGG + Intergenic
1010279495 6:74007674-74007696 ATATATATCCAGTAATGGGATGG + Intergenic
1010302641 6:74280067-74280089 AAATAACTCCATTAGTAGGAGGG + Intergenic
1010516987 6:76785366-76785388 ATATCTCTCCACTAGAATGTAGG + Intergenic
1011249570 6:85356788-85356810 ATATATACCCAGTAATAGGATGG - Intergenic
1011481661 6:87799888-87799910 ATATAACACCTGTAGTATAAAGG - Intergenic
1011755669 6:90496249-90496271 ATGTATCTCCATGAGTAAGAGGG + Intergenic
1012365273 6:98431579-98431601 AAATATCACCACTAGTGTGAGGG + Intergenic
1012503583 6:99918360-99918382 AAATATGGCCAGTAGTTTGAAGG - Intergenic
1012915766 6:105168743-105168765 ATCTCTCTCCAGTCCTATGATGG - Intronic
1013839081 6:114368690-114368712 ATATGTCCCAAGTACTATGATGG + Intergenic
1013849403 6:114495909-114495931 ATAAATTACCAGTGGTATGAAGG + Intergenic
1013949505 6:115762931-115762953 ATATATATCCAGTAATGGGATGG - Intergenic
1014541719 6:122683850-122683872 ATAAATATCCAGAAGTGTGATGG - Intronic
1014702142 6:124703064-124703086 AAATATACCCAGTAGAATGATGG - Intronic
1015721560 6:136247924-136247946 ATATATATCCAATTGTCTGAAGG + Intronic
1016199390 6:141389069-141389091 AAATATCTTCAGTTCTATGAAGG - Intergenic
1016732846 6:147444869-147444891 TCATATGTCCAGTAGTGTGAAGG - Intergenic
1017493194 6:154961942-154961964 ATATATTTCAAGTATAATGATGG + Intronic
1020706596 7:11551828-11551850 GTATATACCCAGTAGTAGGATGG - Intronic
1021309660 7:19078251-19078273 ATAAATACCCAGTAGTAGGATGG - Intronic
1021354621 7:19638867-19638889 AAATATCTCCAATACTAGGATGG - Intergenic
1021371402 7:19852863-19852885 AAATATCTACAATAGTAAGATGG + Intergenic
1024405455 7:48974401-48974423 ATATATAACCAGTAATAGGATGG - Intergenic
1027767764 7:82366729-82366751 ATATATATCCAGTAATGGGATGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027858619 7:83545832-83545854 ATATATCTCCAGTAGTATGACGG + Intronic
1030306433 7:108023661-108023683 AAATATCTCCAATATTAGGATGG - Exonic
1030458292 7:109800609-109800631 GTATATACCCAGTAATATGATGG - Intergenic
1030629622 7:111881558-111881580 ATATATATCCAGTAGGGGGATGG - Intronic
1030643305 7:112030530-112030552 ATTTATTTCCTGTAGTTTGAGGG + Intronic
1032331162 7:130981454-130981476 ATATATACCCAGTAGTGGGATGG - Intergenic
1037140289 8:15511227-15511249 ATTTCTCTCCAGTAGAAGGAGGG + Intronic
1038878564 8:31580603-31580625 ACATTTCTCCAGTATTATGTTGG + Intergenic
1041758695 8:61340689-61340711 CTATATGCCCAGTAGTAGGATGG + Intronic
1043021963 8:75013267-75013289 ATATAGCCCCAGTAATATGGGGG + Intronic
1043045635 8:75320388-75320410 ATATTTCATCAGTAGTATGCTGG + Intergenic
1043205431 8:77433000-77433022 ACATATACCCAGTAGTGTGATGG + Intergenic
1045072946 8:98529560-98529582 ATATATACCCAGAAGTAAGATGG - Intronic
1045708775 8:104959192-104959214 ATATATACCCAGTAGTGGGATGG + Intronic
1046018820 8:108639002-108639024 ATATCTCTCCAGGAGACTGATGG - Intronic
1046892193 8:119434708-119434730 AAATATCTCCTGGACTATGATGG + Intergenic
1047124986 8:121949959-121949981 ACAGATCTACAGTAGCATGAAGG + Intergenic
1047451676 8:124970614-124970636 ATATTTCAGCAGAAGTATGAAGG - Intergenic
1048093493 8:131265941-131265963 ATATATATCCAGTAATGGGATGG - Intergenic
1050007650 9:1149830-1149852 GTATATATCCAGTAATGTGATGG - Intergenic
1050518271 9:6468905-6468927 TTATCTCTCCAGCAGTAGGAAGG + Intronic
1052188473 9:25627769-25627791 ATATATCTCCTGGTGTATGTAGG - Intergenic
1055214694 9:73844906-73844928 AAATATCAGCATTAGTATGAAGG + Intergenic
1055479872 9:76698944-76698966 ATACAGCTCCACAAGTATGAGGG + Intronic
1056856215 9:90131862-90131884 AAATATCTCCACTTGCATGAGGG - Intergenic
1057985980 9:99714578-99714600 CTTTAACTCCATTAGTATGACGG + Intergenic
1058124858 9:101179581-101179603 GTACATTTCCAGTTGTATGAAGG + Intronic
1058801236 9:108546198-108546220 ATTAATCTTCAGTAGTATGTTGG - Intergenic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1059781462 9:117532521-117532543 AAATATCTAGAGTATTATGATGG - Intergenic
1061243494 9:129388206-129388228 ATAAATGTCCAGGAGTAGGATGG + Intergenic
1061616339 9:131782097-131782119 GTATATATCCAGTAGTAGGATGG + Intergenic
1203694946 Un_GL000214v1:89534-89556 ATATATATCCAGTAATGGGATGG - Intergenic
1203704600 Un_KI270742v1:27900-27922 ATATATATCCAGTAATGGGATGG + Intergenic
1203559402 Un_KI270744v1:37913-37935 ATATATATCCAGTAATGGGATGG - Intergenic
1203641327 Un_KI270751v1:14529-14551 ATATATATCCAGTAATGGGATGG + Intergenic
1187717356 X:22115963-22115985 ATATATACCCAGTAGTGGGATGG + Intronic
1193013234 X:76701906-76701928 TTTTATCTCCAGTATTTTGAGGG - Intergenic
1196191463 X:112799523-112799545 ACATATAACCAGTGGTATGAAGG - Intronic
1196656805 X:118227101-118227123 ATATGTATCCTGAAGTATGAAGG - Intergenic
1199331059 X:146560018-146560040 AAATATCTTCAGTTGTATGGTGG + Intergenic
1201936190 Y:19413166-19413188 ATATATACCCAGTAATAGGATGG + Intergenic
1201942433 Y:19474303-19474325 ATGCATCACCAGTAGTGTGAGGG + Intergenic
1202349321 Y:23970830-23970852 ACATATCTTCACTAGTATGCGGG - Intergenic
1202521454 Y:25699274-25699296 ACATATCTTCACTAGTATGCGGG + Intergenic