ID: 1027862862

View in Genome Browser
Species Human (GRCh38)
Location 7:83607162-83607184
Sequence AGTTATGTAAGTACAGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027862862 Original CRISPR AGTTATGTAAGTACAGCTTT AGG (reversed) Intronic
908793475 1:67806498-67806520 ACTTAAGTATGTACAGATTTTGG + Intronic
909067376 1:70951642-70951664 AGTTAATTAAGTGCATCTTTAGG - Intronic
910391019 1:86744501-86744523 AGTCATGTAACTCCAGTTTTGGG + Intronic
910519127 1:88098012-88098034 ATGTATGTAAGTAAATCTTTTGG - Intergenic
911863227 1:102982427-102982449 AGTGATGTAAGGATAGCTTGAGG + Intronic
913275164 1:117130359-117130381 AGTGGTGAAAGGACAGCTTTTGG + Intergenic
915417625 1:155754164-155754186 AATTCTGTGAGTAAAGCTTTTGG - Intronic
916679789 1:167093941-167093963 AGTTAAGTGAGGACTGCTTTGGG + Intergenic
918590821 1:186239054-186239076 AGTTATCTAAGTACAGATGAGGG + Intergenic
919097575 1:193056637-193056659 AAGTATGTAAATACAGATTTTGG - Intronic
919212390 1:194504443-194504465 AGCTATGTTTTTACAGCTTTGGG + Intergenic
920554163 1:206891801-206891823 AGCTATGTAAATACAACTTCAGG - Intergenic
921363781 1:214354868-214354890 AGTTATCTAGTTAGAGCTTTTGG - Exonic
923191122 1:231621827-231621849 AGCTATGTATGTACAGCTGTTGG + Intronic
924356424 1:243181459-243181481 AGTTATGAGATTACAGCATTTGG - Intronic
1063876952 10:10489883-10489905 ATCTATGTGAGTACAGGTTTGGG + Intergenic
1064047036 10:12026184-12026206 AGATATGCAAGTACACATTTAGG + Intronic
1065086750 10:22186358-22186380 AGTTAAGTAAGCAGAGGTTTGGG + Intergenic
1069755191 10:70770356-70770378 AGAAATGTAACCACAGCTTTTGG + Intergenic
1070992799 10:80747121-80747143 AGGGATATAAGTACAGCATTGGG - Intergenic
1071256058 10:83872829-83872851 AGAAATGTGAGCACAGCTTTAGG - Intergenic
1073534806 10:104267354-104267376 TGTTCTGTAAGTAGAGCTCTAGG - Exonic
1073885891 10:108039111-108039133 ATTAATGAAAGTGCAGCTTTGGG + Intergenic
1073938493 10:108664347-108664369 AGTTTTGTAATTAAAACTTTGGG + Intergenic
1077659654 11:4056249-4056271 AGTTATGAAACAACAGCTGTTGG - Intronic
1080113148 11:28592307-28592329 ATTGATGTAAGTACTGCTATAGG + Intergenic
1080132217 11:28809920-28809942 CGTTATTTAAATAAAGCTTTTGG - Intergenic
1080229973 11:30009501-30009523 AGTTATATAAGAACAGAATTTGG - Intergenic
1080996606 11:37609762-37609784 TGTTATGAAAATACAGATTTAGG - Intergenic
1081333075 11:41828005-41828027 AGTTTTGTAAGTACAGTTGTTGG + Intergenic
1082019317 11:47518442-47518464 AGTTCTATAAATACAGCTTTTGG + Intronic
1085365914 11:75944358-75944380 AGGTATGTCAGGATAGCTTTGGG + Intronic
1085549711 11:77357449-77357471 AGGCATGGAAGTACAGGTTTAGG - Intronic
1085663477 11:78391665-78391687 AGGTATGTAAGTGATGCTTTCGG + Intronic
1086003573 11:82009430-82009452 AGTTATATAAAAACAGGTTTTGG - Intergenic
1087045616 11:93841611-93841633 AGTTCTAAAAGTACAGTTTTGGG - Intronic
1087410093 11:97780649-97780671 AGTGATCCAGGTACAGCTTTTGG + Intergenic
1088679843 11:112230069-112230091 AAATATTTAAGTATAGCTTTTGG + Intronic
1090566179 11:127994248-127994270 AGTTATGTAAGTACAGTTTAGGG + Intergenic
1091180949 11:133604051-133604073 AGTTATGTATGTCCCACTTTTGG + Intergenic
1091580212 12:1782276-1782298 ATATATGTAAGCACAGCTATGGG - Intronic
1094343014 12:29433734-29433756 AGTTATGTAAGTATATCATAAGG - Exonic
1097518126 12:60632735-60632757 ATTTATGTTTGTACAGCCTTGGG + Intergenic
1097623875 12:61976076-61976098 AGTTATGTAATTATATCGTTTGG - Intronic
1098359944 12:69644722-69644744 AGGCATGTAAGTACAGCATTGGG + Intronic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1100131941 12:91505632-91505654 ATTTATGTAAGTACAAATGTTGG + Intergenic
1101287144 12:103326516-103326538 AGGTATGTAAGTAGAGCGGTAGG - Intronic
1101643342 12:106604806-106604828 AATTATGTAAGTAGAGTTTTAGG + Intronic
1102301632 12:111775715-111775737 TGTTATGTAAGTCGAGCTTCGGG + Intronic
1106007836 13:25787763-25787785 AGTCCTGGAAGTCCAGCTTTGGG + Intronic
1111107535 13:83667021-83667043 ACTTGTGGAAGTACAGCATTTGG - Intergenic
1111181130 13:84666598-84666620 TCTTATGAAAGTGCAGCTTTTGG - Intergenic
1116043474 14:39714505-39714527 AGATATGTAAGTTCAATTTTAGG + Intergenic
1116457918 14:45140738-45140760 AGTTAAGAAAATAAAGCTTTTGG + Intronic
1119929245 14:78528741-78528763 AGTCGTGCAAGTACAGATTTGGG + Intronic
1121676325 14:95756138-95756160 AGTTAAGTCAGTTCAACTTTAGG - Intergenic
1122584392 14:102794887-102794909 AGTTTTTCAAGTACAGCTTTGGG + Intronic
1123819863 15:24017759-24017781 TGTGAAGTAAGTACAGCATTAGG + Intergenic
1128014894 15:64334918-64334940 AGTTATAGAAGTACACTTTTTGG - Intronic
1130648252 15:85747201-85747223 AGGTATGTAAGCACAGTTCTTGG - Intronic
1130698838 15:86158567-86158589 GGTTAGGTAAATACAACTTTTGG - Intronic
1131716962 15:95121945-95121967 AGCTATGTTAGTCCAGCTTTTGG + Intergenic
1134037074 16:11039402-11039424 ATTTATGTAAGTTCAGTTTATGG + Intronic
1134567215 16:15261983-15262005 AGTTAAGTCAGCACAGCTCTAGG - Intergenic
1134735276 16:16494717-16494739 AGTTAAGTCAGCACAGCTCTAGG + Intergenic
1134932245 16:18217500-18217522 AGTTAAGTCAGCACAGCTCTAGG - Intergenic
1137910368 16:52372254-52372276 AGTTATGAAAGCACAACTTCAGG + Intergenic
1140579601 16:76214006-76214028 AGTATTTTAAGAACAGCTTTTGG - Intergenic
1149219079 17:54393968-54393990 AGTTATATATGTACAGTGTTTGG - Intergenic
1150672751 17:67216201-67216223 AGTTTTCTCAGTAAAGCTTTTGG - Intronic
1151038118 17:70824650-70824672 ACTTATAAAAGTACAGATTTTGG + Intergenic
1151141668 17:71998937-71998959 ACTTATTTAAGTACAGATTTTGG - Intergenic
1153677732 18:7470420-7470442 AGCTATGTAAGTCCATCTTAGGG + Intergenic
1153856674 18:9155452-9155474 ATTTGTGTAAGTACACCTGTAGG + Intronic
1156144259 18:34157190-34157212 AGTAATATAATTCCAGCTTTTGG - Intronic
1156753465 18:40490721-40490743 AGTTTTGTAAATACAGTTTATGG - Intergenic
1157788980 18:50513638-50513660 AGTTTTGTTAGTACATCCTTAGG - Intergenic
1157910381 18:51612429-51612451 ATTTACGTAAGTACATCTATCGG + Intergenic
1158318796 18:56241004-56241026 AGTAATACAAGTAAAGCTTTTGG + Intergenic
1158449406 18:57550398-57550420 ACCTATTTAAGTACAGATTTTGG - Exonic
1160117171 18:76090248-76090270 ATTGGTGTAAGTACATCTTTAGG - Intergenic
1160476543 18:79194911-79194933 ACTTGGGTAAGTAAAGCTTTGGG + Intronic
1166621758 19:44307268-44307290 AGTTAAGTAAGTTAAGTTTTGGG - Intergenic
925365197 2:3306542-3306564 ATTTATGTTAGTACAGCTTCTGG - Intronic
926105234 2:10145760-10145782 AGTTATGAAACCACAGCTTCTGG - Intronic
927035303 2:19168704-19168726 AGATATGTAAGAGTAGCTTTTGG - Intergenic
930749355 2:54918069-54918091 AATTGTGTAAGTACAGGCTTGGG - Intronic
935153762 2:100463867-100463889 AGTTATGTATGTACAGATGTAGG - Intergenic
939047932 2:137271245-137271267 AGGTATGTGAGTACGGCTCTGGG - Intronic
939542117 2:143507234-143507256 AATAATGAAATTACAGCTTTTGG - Intronic
939630302 2:144520684-144520706 AGGTATCTCAGTACAGCTTCTGG + Intronic
940489331 2:154337880-154337902 ATTTATATTAGTAAAGCTTTGGG + Intronic
940620886 2:156111874-156111896 AGATATGTAAGAACAGAGTTGGG - Intergenic
941411439 2:165161484-165161506 AGTCATATAAATAGAGCTTTGGG - Intronic
941493740 2:166175138-166175160 AGTTATCTGAGTACAGCCCTTGG - Intergenic
941778204 2:169415452-169415474 GGTGATGTCAGTTCAGCTTTTGG - Intergenic
943263533 2:185696894-185696916 ACTTGAGTAAGTACAGATTTTGG + Intergenic
944093252 2:195937534-195937556 AGTTCTTTAAGATCAGCTTTTGG - Intronic
945840403 2:214880953-214880975 AGTTCTTTAAGTACAGCTCTAGG - Intergenic
946263092 2:218512937-218512959 AGTAATGTCAGTACTGATTTGGG + Intronic
1170105408 20:12750126-12750148 AAGTATGTAAGTACAGATATAGG - Intergenic
1170461225 20:16578339-16578361 AGTAATTTTAGTAAAGCTTTAGG + Intergenic
1171050277 20:21851566-21851588 AGATAAGTAAATACAGCATTTGG + Intergenic
1175561746 20:59936270-59936292 AGTGGTGTAAGTACAGCCATAGG - Intronic
1177284808 21:19036123-19036145 AGTTATGTAAGGACAACTGTGGG - Intergenic
1178413674 21:32386716-32386738 TGTCATGTAAGTAAAGCTCTTGG - Intronic
1181659867 22:24338041-24338063 AGTTATGTAAATACTCCTCTTGG + Intronic
1181716630 22:24735427-24735449 AGTTTTTTAAGTTCAGTTTTTGG + Intronic
1182048338 22:27294192-27294214 AGTTATAAATGTGCAGCTTTCGG - Intergenic
1182636536 22:31732000-31732022 ACTTCTGTAAGTACATCTTTTGG - Intronic
949092906 3:50564-50586 AGTAAAGTGAGTACAGATTTTGG - Intergenic
949217416 3:1586120-1586142 TGTTAGGTAAGTACACATTTAGG - Intergenic
949887479 3:8707773-8707795 AGTTATGTGATTACAGCTCTTGG + Intronic
950671178 3:14526351-14526373 AGGTATGTAAGCACAGCCCTGGG - Intronic
953396561 3:42576957-42576979 ACTTATGTAAGTATATTTTTGGG - Intronic
956127421 3:66024124-66024146 AGTAATGCAATTACTGCTTTTGG + Intronic
957023036 3:75145411-75145433 ATGTATGTATGTGCAGCTTTGGG - Intergenic
957033172 3:75266658-75266680 AGTAAAGTGAGTACAGATTTTGG - Intergenic
958087122 3:88824792-88824814 AGTTATGAAAGTTAGGCTTTGGG - Intergenic
959193447 3:103145300-103145322 TGTTATGTAAAAACTGCTTTGGG + Intergenic
959423493 3:106156583-106156605 AGAACTGTGAGTACAGCTTTAGG + Intergenic
961156813 3:124686599-124686621 AGTTATGTAGGAAGAGCTGTAGG + Intronic
963479567 3:145853826-145853848 TGTTATGTAAATACAAATTTTGG + Intergenic
965006328 3:163030678-163030700 TTTTATGTAAGTAAAGGTTTGGG + Intergenic
966254858 3:177906256-177906278 AGTTATGTAACTACATTTTTAGG - Intergenic
967086459 3:186099163-186099185 CATAATGTAAGTACACCTTTGGG - Intronic
970623708 4:17853858-17853880 TGTTAAGTAAGTACTGCTTGAGG - Intronic
970793370 4:19886574-19886596 AGTTATGACAGTAAAACTTTTGG + Intergenic
972820221 4:42693282-42693304 ATTTATTTAATTACAGTTTTAGG + Intergenic
972853160 4:43074313-43074335 AGGGATATAAGTACAGCATTGGG - Intergenic
976961078 4:90974709-90974731 AGATAGGCAAGTACAACTTTTGG + Intronic
977720352 4:100232478-100232500 ACTTATGGCAGTACAGTTTTTGG - Intergenic
977934714 4:102788318-102788340 AATTCTGGAAGTACTGCTTTTGG + Intergenic
979080409 4:116331817-116331839 AATTAAGTGAGTACAGCTTTGGG - Intergenic
980416406 4:132495044-132495066 ATATATGTAAGTACATCTATAGG + Intergenic
981082285 4:140647533-140647555 AGTTTTACAAGGACAGCTTTGGG - Intronic
981315651 4:143337255-143337277 CGTTATGTAAGTAGAGCTGCGGG + Exonic
985882660 5:2651590-2651612 AGTTAAGTTAGCTCAGCTTTCGG - Intergenic
986473462 5:8098592-8098614 AGTTGTGTAATCTCAGCTTTGGG + Intergenic
987208481 5:15653078-15653100 TCTTATGTAAGTACAGTTTGTGG + Intronic
988013525 5:25522593-25522615 AGTTATGTAACCACAGCTTCTGG - Intergenic
988457728 5:31402117-31402139 ACTTTTGCAAATACAGCTTTGGG - Intronic
989766198 5:45086403-45086425 AGTTATTAAAATACAGGTTTAGG - Intergenic
989970222 5:50515052-50515074 TGGTATGTAAGTACTGCATTGGG + Intergenic
990087854 5:52000851-52000873 AGTTATGTTTGTAAAGGTTTAGG + Intergenic
994457873 5:100035939-100035961 AGTTCTGTAAGTAAACTTTTTGG - Intergenic
994868855 5:105317117-105317139 AGTGATATAAATACAGCTGTGGG - Intergenic
995132386 5:108644234-108644256 AGTAATGTAAGTACAGGTAGGGG + Intergenic
995923124 5:117337767-117337789 AATTATGTATGTAAAGCTCTAGG + Intergenic
996204751 5:120718755-120718777 AGTTATGAGGGTTCAGCTTTAGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999407788 5:151322656-151322678 AGTTATGTGCCTAGAGCTTTGGG - Intronic
999476358 5:151902764-151902786 AGTATTGTAAATAAAGCTTTTGG - Intronic
1001869593 5:175139518-175139540 AGTTATGCATGTAAAGCTTAGGG - Intergenic
1008316260 6:50045663-50045685 ATTTGTGTAAGTACAGTTTATGG - Intronic
1010101637 6:72116294-72116316 AGATGTGTAAGTACAGATGTTGG + Intronic
1011203335 6:84862659-84862681 AGGTATATAAGTACAGGTATAGG + Intergenic
1013833991 6:114310316-114310338 AGTTGTGTAAGAAAAGGTTTGGG + Intronic
1013940185 6:115651782-115651804 AGTTATTTAAGTCGAGCTTCGGG - Intergenic
1015264177 6:131273717-131273739 ACTTACGTATGTACAGTTTTTGG + Intronic
1016555764 6:145335617-145335639 AGATATATAATTACTGCTTTGGG - Intergenic
1018273115 6:162101799-162101821 AGTTATGTAAATAAAGCTGGAGG - Intronic
1020431302 7:8118981-8119003 TGTTATGTAAGTAAAAGTTTGGG + Intronic
1020911747 7:14139997-14140019 AGATATTTAAGTAAAGCTGTAGG + Intergenic
1022454236 7:30544506-30544528 AGATAAGTAAGTACAGCTAAAGG + Intronic
1023426960 7:40047127-40047149 AGCAATGTAACTTCAGCTTTAGG + Intronic
1024918415 7:54530198-54530220 AGTAAAATAAGTACAGATTTGGG + Intergenic
1025970050 7:66314653-66314675 ATTTATGTAAGTACACCCTATGG - Intronic
1026083752 7:67245278-67245300 AGTTTTGTAATTATTGCTTTAGG - Intergenic
1027746215 7:82077796-82077818 ATTTATAGAAGTACTGCTTTTGG - Intronic
1027862862 7:83607162-83607184 AGTTATGTAAGTACAGCTTTAGG - Intronic
1027876200 7:83772470-83772492 AGTTATATAACTAAATCTTTTGG - Intergenic
1028607614 7:92672122-92672144 ATATATATATGTACAGCTTTTGG - Intronic
1028917784 7:96278529-96278551 AGGTAAGTAACTAAAGCTTTTGG + Intronic
1034512971 7:151551362-151551384 ATTTAATTAAGTACTGCTTTAGG - Intergenic
1034784040 7:153909150-153909172 AGATCTGTAAGTAAATCTTTTGG - Intronic
1037120370 8:15278159-15278181 TGTTATGTGAATGCAGCTTTTGG - Intergenic
1039641018 8:39221773-39221795 ATTGATGTAATTACAGCTGTAGG - Intronic
1040983303 8:53267717-53267739 AGGGATGCAAGTACAGCATTGGG + Intergenic
1041061184 8:54036198-54036220 TGTAATGAAAATACAGCTTTCGG + Intergenic
1041961365 8:63620565-63620587 ATTTATGTAAGTAAAGCAGTAGG + Intergenic
1043842433 8:85124134-85124156 AATTATGAAAGTACAGATATTGG - Intronic
1044463679 8:92479181-92479203 GGTTTTGTAAGTACAATTTTGGG - Intergenic
1045851705 8:106707575-106707597 AATTCTGTAAGTACACTTTTAGG - Intronic
1047009384 8:120654524-120654546 AGTTATGTAAATACTGCCTATGG + Intronic
1048565060 8:135587485-135587507 AGTTATTTAAGTATAAATTTGGG + Intronic
1052249347 9:26379026-26379048 AGTTATTTAATGGCAGCTTTGGG - Intergenic
1054902274 9:70381968-70381990 TTTTCTGTAAGTACTGCTTTAGG + Intergenic
1055369226 9:75579116-75579138 ATTTATTGAAGTACAGTTTTAGG - Intergenic
1188637961 X:32459295-32459317 AATTAAATATGTACAGCTTTTGG + Intronic
1189894675 X:45642569-45642591 AGTTTTGTAACTACAAATTTAGG + Intergenic
1192133063 X:68571010-68571032 AGTTCTTTAAGTATAGCTTCTGG - Intergenic
1192605163 X:72508922-72508944 CATTAAGTATGTACAGCTTTTGG - Intronic
1192681446 X:73257858-73257880 AGGAATATAAGTACAGCTTTTGG + Intergenic
1194448937 X:94018269-94018291 TGTTGTGTAAGTACAGAGTTAGG + Intergenic
1195429597 X:104773678-104773700 AGTTATGTAAATATAACTTCTGG + Intronic
1196174950 X:112630287-112630309 TGTTCCGTAACTACAGCTTTAGG - Intergenic
1201972189 Y:19810273-19810295 AGGGATATAAGTACAGCATTGGG + Intergenic