ID: 1027867132

View in Genome Browser
Species Human (GRCh38)
Location 7:83662490-83662512
Sequence TCTAGAAAACCGTAGTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027867132_1027867133 -3 Left 1027867132 7:83662490-83662512 CCTATGAACTACGGTTTTCTAGA No data
Right 1027867133 7:83662510-83662532 AGATTTGTTAGTTGTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027867132 Original CRISPR TCTAGAAAACCGTAGTTCAT AGG (reversed) Intergenic
No off target data available for this crispr