ID: 1027867253

View in Genome Browser
Species Human (GRCh38)
Location 7:83663400-83663422
Sequence AGCTGTGAGGTGCACAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027867245_1027867253 21 Left 1027867245 7:83663356-83663378 CCACAGACTCAGCCTGGCTGGCA No data
Right 1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG 0: 1
1: 0
2: 0
3: 9
4: 152
1027867249_1027867253 -2 Left 1027867249 7:83663379-83663401 CCAGCGATGGCCCTGCAGTGGAG No data
Right 1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG 0: 1
1: 0
2: 0
3: 9
4: 152
1027867247_1027867253 9 Left 1027867247 7:83663368-83663390 CCTGGCTGGCACCAGCGATGGCC No data
Right 1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027867253 Original CRISPR AGCTGTGAGGTGCACAACAC AGG Intergenic
900104123 1:974988-975010 AGGTGTGAGGAGCACAAGCCAGG + Exonic
900669114 1:3838888-3838910 AACTGTGTGGTTCACAACAGTGG - Intronic
900908355 1:5576485-5576507 AGCTGTGAAGAGCACAGCAAAGG + Intergenic
901131940 1:6967403-6967425 AGCTGGGAGGTGCAAAGCATGGG - Intronic
901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG + Intergenic
903002219 1:20274350-20274372 AGCTGTGAGGACCACAAAAGTGG + Intergenic
905300713 1:36984778-36984800 GGCTGTGAGGTGCAGAGCCCAGG + Intronic
906538346 1:46564965-46564987 AGCTGGGAGGTCCAGAACAGAGG - Intronic
906816450 1:48885135-48885157 AGCTGTGAGCTAAACAAAACAGG - Intronic
907385344 1:54122162-54122184 AGCTGTGAGGGGCACGGCAGGGG - Intergenic
907616143 1:55928887-55928909 AGCTGTGAGATGTAAAAAACAGG - Intergenic
908147545 1:61263367-61263389 TGCTGTGAGGAGCCCAGCACAGG + Intronic
909207328 1:72775897-72775919 AGCTGTGAGTTGCTGAAAACCGG - Intergenic
910102549 1:83594181-83594203 AGCTGTGAGCTGCACCACCTGGG + Intergenic
911858431 1:102912968-102912990 TGCTGTGAGGTACACAAGAATGG - Intronic
915154738 1:153865784-153865806 AGCTGAGAGGTGGACATGACAGG + Intronic
920203365 1:204274496-204274518 ACCTGTGGGGTGCACCACCCTGG + Intronic
920949024 1:210555429-210555451 AATTGTGAGGTGAACAAGACTGG + Intronic
922879972 1:228973528-228973550 AGGGGTGAGGTGCACACCTCCGG + Intergenic
1062871209 10:906483-906505 ACCTGTGGGTTGCACCACACTGG - Intronic
1063078324 10:2739128-2739150 AGCTGGGAAGCACACAACACAGG + Intergenic
1065746438 10:28846673-28846695 AGCTGAGAGCTGTAAAACACAGG + Intronic
1066643172 10:37576970-37576992 AGCTGTGAGTTACACAACTGTGG + Intergenic
1074392958 10:113073200-113073222 AGAAGTGAGGTGGACCACACAGG - Intronic
1074989242 10:118687904-118687926 GGCAGTGGGGTGAACAACACAGG - Intronic
1075279762 10:121129496-121129518 AGTTGGGAGGTGAACAACTCTGG + Intergenic
1076171370 10:128322981-128323003 AGTTATCAGGTGCACAACAAGGG + Intergenic
1076621390 10:131790556-131790578 AGCAGTGACTTCCACAACACTGG + Intergenic
1080715306 11:34794453-34794475 AGCTGTGAGCTCCACACCCCTGG + Intergenic
1082652612 11:55812185-55812207 AGCTGTGAGGTGGGAAGCACAGG - Exonic
1085677498 11:78538171-78538193 TGCTGTGAGGTGAACAACGTAGG - Intronic
1087958728 11:104322020-104322042 AGCTGTGATCTGCACAAGTCAGG - Intergenic
1088896672 11:114083678-114083700 AGCTGGGTGGTACAGAACACGGG - Intronic
1089209476 11:116790675-116790697 AGCCGCGTGGTGCACCACACCGG - Exonic
1090063508 11:123484139-123484161 AGATGTTTGGTGCACAGCACAGG - Intergenic
1090656196 11:128847692-128847714 AGCTGTGATGTCCCCACCACTGG + Intronic
1091810345 12:3391705-3391727 GTCTGTGAGGTTCTCAACACTGG + Intronic
1093459388 12:19394591-19394613 AGCTGTGAAGTACACAATAGAGG - Intergenic
1093910968 12:24747084-24747106 AGCTGGGAGGGGAACAACAGAGG + Intergenic
1094222384 12:28008525-28008547 AGCTGTGAAGAGCACAGCTCTGG + Intergenic
1095625043 12:44304528-44304550 AGCTGTGAGCTGCACTACTAGGG - Intronic
1099150874 12:79111784-79111806 AGCTGTGAGGGAAACAACACTGG - Intronic
1105987752 13:25585775-25585797 GGCTGTGAGGGTGACAACACTGG + Intronic
1107216036 13:37919905-37919927 AGCTGTAAGGACTACAACACCGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1108570959 13:51750829-51750851 ACTTGTGAGGTGCACACCTCAGG + Intronic
1111293870 13:86255477-86255499 GGCTGTGCGCTGCACAACTCGGG - Intergenic
1111988505 13:95090429-95090451 CTCTGTGAGGTTCACATCACAGG + Intronic
1113977061 13:114235311-114235333 AGCTGGGAGGGGCACAGCCCGGG + Intronic
1116869035 14:50054420-50054442 TGCTGTGAGCTGAACATCACAGG + Intergenic
1118753226 14:68821284-68821306 AGCTGGGAGGTGCTCAACCCTGG + Intergenic
1121572858 14:94960677-94960699 AGCTGTGAAGTGCCCAGCCCTGG + Intergenic
1121728912 14:96172813-96172835 TGCTGAGAGGTGAACAACATTGG - Intergenic
1122134362 14:99624404-99624426 AGCTGTGAAGTCCACGACACAGG + Intergenic
1128716539 15:69912704-69912726 AGCTGGGATGTGCACAAAGCTGG + Intergenic
1132381422 15:101369190-101369212 TGCTGTGGGGGGCACAGCACAGG + Intronic
1132381727 15:101370873-101370895 TGCTGTGGGGTGCACAGCACAGG + Intronic
1133672070 16:8032435-8032457 AGTTGTCAGGGGCACAATACAGG - Intergenic
1133760555 16:8795339-8795361 ATATGTGAGGGGCACAGCACAGG + Exonic
1134095390 16:11415324-11415346 AGCCGTGAGCTGCACCCCACGGG - Intronic
1135124875 16:19800256-19800278 GGCTGTGCGCTGCACAACTCGGG + Intronic
1136616268 16:31400381-31400403 AGGTGTGAGGCCCACACCACAGG - Intronic
1138971544 16:62150354-62150376 AGCTGTGGGAGGCAGAACACGGG - Intergenic
1139696463 16:68678741-68678763 AGCTGTGGGGTACACAGCTCTGG - Exonic
1141307463 16:82879125-82879147 AGCTGTGATGTCCACAACCATGG - Intronic
1141867808 16:86762694-86762716 AGCTTTGTGGTGAATAACACGGG + Intergenic
1142135697 16:88451088-88451110 AGCTGGGAAGGGCACCACACCGG + Intergenic
1142154170 16:88525732-88525754 CGCTCTGTGGTGCCCAACACTGG - Intronic
1146630207 17:34464114-34464136 GCCTGTGGGGGGCACAACACTGG + Intergenic
1151341137 17:73471708-73471730 AGGTGTGAGGTGGACCACAGAGG + Intronic
1153863245 18:9234918-9234940 AGCTGTGAGGGGCTCAATATTGG - Intronic
1154430714 18:14306405-14306427 AGGTGTGAAGAGCACAAAACTGG + Intergenic
1156369008 18:36456002-36456024 ACATTTGAGGTGCACAACTCGGG - Intronic
1158112899 18:53961564-53961586 TGCTGAGAGGTGCACAAGCCTGG - Intergenic
1162498853 19:11039580-11039602 CGCTGAGGGCTGCACAACACTGG + Intronic
1162766644 19:12923987-12924009 AGCTGTCATGTTCACAGCACGGG + Intronic
1163304734 19:16471126-16471148 AGCTGTGATTAGCATAACACAGG + Intronic
1163526415 19:17824397-17824419 AGTTATGAGGTGCACATGACGGG + Intergenic
1165475862 19:36030475-36030497 AGCTGTGAGGTTCAGAAACCAGG - Intronic
1165851145 19:38851054-38851076 AGCTGTCAGGTGAAAACCACTGG - Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925106581 2:1297457-1297479 ATCTTGGAGTTGCACAACACAGG + Intronic
925146448 2:1586203-1586225 AGCAGTGAGCTCCACATCACAGG + Intergenic
925691603 2:6529654-6529676 AGCTGTGACCTGCAGAATACAGG + Intergenic
925807073 2:7661021-7661043 GGCTGTGATGTGCACACCACGGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
931012235 2:57930003-57930025 AGCTGTGAGCTGCACCACCTGGG + Intronic
936816309 2:116465144-116465166 AGCTGTGTGGTACTAAACACAGG - Intergenic
937262495 2:120595494-120595516 GGCTGTGAGGAGAACAAGACAGG - Intergenic
937925041 2:127161649-127161671 AGCTGTGATGGGCACAGCACAGG + Intergenic
938081731 2:128373814-128373836 AGCTGTGGGGTGCACTGAACTGG + Intergenic
946298019 2:218801862-218801884 TGGTGTGAGGTGCACAAGGCAGG + Intronic
948432899 2:237931355-237931377 AGGTGTGCGCTGCACAACTCAGG - Intergenic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1174092780 20:48062727-48062749 AGCTGTGAGGTGGACACTGCAGG - Intergenic
1178102687 21:29286799-29286821 AGCAGAGAGGTGCACAAAAATGG + Intronic
1178108544 21:29348505-29348527 AGTTGTGAGTTACAGAACACTGG - Intronic
1178207751 21:30488969-30488991 AGGTGTGAGGTGCACACCTGTGG + Intronic
1179017102 21:37603407-37603429 GGCTGGCAGGGGCACAACACTGG - Intergenic
1180979298 22:19871272-19871294 AGCTGGGATCTGCACAGCACTGG + Intergenic
1182486745 22:30643645-30643667 ACATGTGAGGTGCTGAACACAGG - Intronic
1184350746 22:43942201-43942223 AGCTGTGTGGTGGACAGCCCAGG - Intronic
1184464414 22:44660490-44660512 AGCCATGGGGTGCACAACATGGG + Intergenic
951236816 3:20245888-20245910 AACTTTCAGGTGCACAAGACAGG - Intergenic
952368669 3:32698067-32698089 AACTGTCAGGTGCACAAAAGAGG - Intronic
953867624 3:46597710-46597732 AGCTGTGAAATGCACAGCAAGGG - Intronic
953940298 3:47089090-47089112 AGCTTTGAGGTGCATAAAAATGG - Intronic
954414619 3:50387143-50387165 GGCTGTGGGGTGCTCAGCACAGG + Intronic
955876573 3:63496358-63496380 AGCTATGAGGTCCAAAAAACAGG - Intronic
959084579 3:101837578-101837600 ACCTGTCAGGTGGAAAACACAGG + Intronic
960140852 3:114150712-114150734 GGCCTTGAGGTGCACAACAAGGG - Intronic
960371129 3:116841370-116841392 TGCTGTGAGGTACACCACAAGGG - Intronic
961519308 3:127457395-127457417 AGCTGGGAGGTGGACATGACGGG + Intergenic
963711801 3:148755143-148755165 GGCTGTGGGGTGGACACCACAGG - Intergenic
965433969 3:168624164-168624186 AGCTGTGAGTTGGAAAACTCTGG - Intergenic
968845372 4:3038265-3038287 AGCTCTGAGGTGCCCCGCACGGG + Intronic
968862743 4:3185433-3185455 AGATGTGAAGCTCACAACACTGG - Intronic
969430045 4:7148684-7148706 AGATGTGAGGTGCACCAATCTGG - Intergenic
972487467 4:39555862-39555884 AACTGTGAGGTGGACAGAACTGG + Intronic
977255232 4:94732976-94732998 AGCTGTGAGATGCTAGACACTGG + Intergenic
978654309 4:111048570-111048592 AGCTGTGAGCTGCACTTCCCAGG - Intergenic
985707292 5:1408897-1408919 AGCTGTGATGACCACAACCCAGG + Intronic
986374989 5:7121991-7122013 ATGTGTGAGGTTCACAACTCAGG - Intergenic
989527321 5:42468352-42468374 AGCTGGGAGCTGCCCAGCACAGG + Intronic
989622774 5:43401153-43401175 AGGTGTGAGGTCCACAAGAATGG - Intronic
990024714 5:51172316-51172338 AGCTGTGTGTTGCACAAAAGTGG - Intergenic
992162471 5:74016509-74016531 CTCTCTGGGGTGCACAACACCGG - Intergenic
995697858 5:114900020-114900042 AGCTGTGAGGTGTACTACCTAGG + Intergenic
998189197 5:140008083-140008105 AGATGTGGGGAGCACCACACAGG + Intronic
999256180 5:150211094-150211116 AGCCGTGAGGTGGGCAGCACAGG + Intronic
1001401151 5:171447210-171447232 AGCTTTGGGGTGCACAAATCTGG - Intronic
1004672791 6:17813689-17813711 AGCAATGAGATGCAGAACACAGG - Intronic
1009908849 6:69902499-69902521 ATCTGTCAGGTCCACAACCCAGG + Intronic
1012386386 6:98688254-98688276 AGCTGTGAGCTGAACAGCACTGG + Intergenic
1013117921 6:107115961-107115983 AGCTCTGAGGCTCACAACAGAGG - Intergenic
1013441378 6:110173776-110173798 AGCTGTGAGATACAAAACTCTGG - Intronic
1013481918 6:110560314-110560336 AAATGTGAGGAGCAGAACACTGG - Intergenic
1013654122 6:112227698-112227720 AGCTGTAAGGTGAAAAACAAAGG - Intronic
1015837083 6:137432112-137432134 TGCTGTGATTTGCACAACCCAGG + Intergenic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1034094778 7:148397208-148397230 AGAAGTGCGGTGCACAACCCTGG + Intronic
1034280472 7:149850462-149850484 AGTTATGAGGTGCAAAAGACAGG - Intronic
1035371796 7:158384314-158384336 ATCTCTCAGGAGCACAACACAGG + Intronic
1035562832 8:619172-619194 GGCTGGGAGGTGGGCAACACAGG - Intronic
1036452394 8:8880326-8880348 ATGTGGCAGGTGCACAACACTGG + Intronic
1039151518 8:34512097-34512119 AGCTGTGAGCAGGAGAACACAGG - Intergenic
1040593344 8:48816266-48816288 AGCTGCGATGGTCACAACACGGG + Intergenic
1042560381 8:70069416-70069438 AAGTGTCAGGTCCACAACACGGG + Exonic
1043651283 8:82596141-82596163 AGCATTGAGATGCACCACACAGG - Intergenic
1046330750 8:112712131-112712153 AGATGAGAGTGGCACAACACTGG - Intronic
1053408911 9:37903326-37903348 AGCTGTGAGATGCAAAACAAAGG + Intronic
1060030456 9:120210519-120210541 AGCTGTGAGATGAACAAGATGGG + Intergenic
1060933777 9:127504583-127504605 AGGGCTGAGGTGCAGAACACGGG - Intergenic
1061737447 9:132670872-132670894 ATCTGCGACGTGCACAACCCGGG + Exonic
1061920356 9:133779180-133779202 AGCTGTGCGGGGCAGAAGACGGG + Intronic
1062268280 9:135697327-135697349 AGGTGTGAGGTGACCAACATGGG - Intronic
1062405964 9:136396665-136396687 AGCTGTGAGGGGCAGGACGCAGG + Intronic
1062625965 9:137441624-137441646 AGCTGCGAGGGGCAGAACTCCGG + Intronic
1188199352 X:27280002-27280024 AGCTGGGAGGTATACAACAGGGG + Intergenic
1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG + Intergenic
1192142186 X:68655160-68655182 AGCGGTGAGCTCCACATCACTGG - Intronic
1192237183 X:69303428-69303450 AGCTGATAGGAGCACAACAGGGG - Intergenic