ID: 1027869931

View in Genome Browser
Species Human (GRCh38)
Location 7:83694116-83694138
Sequence CAAAATACACAGAAATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027869926_1027869931 8 Left 1027869926 7:83694085-83694107 CCAGCCTGGGCAAGAGAGTGAGA 0: 454
1: 24894
2: 80134
3: 176700
4: 234018
Right 1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG No data
1027869927_1027869931 4 Left 1027869927 7:83694089-83694111 CCTGGGCAAGAGAGTGAGACTCT 0: 131
1: 8347
2: 37413
3: 95941
4: 176348
Right 1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG No data
1027869925_1027869931 18 Left 1027869925 7:83694075-83694097 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027869931 Original CRISPR CAAAATACACAGAAATTGGA GGG Intergenic
No off target data available for this crispr