ID: 1027878590 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:83802703-83802725 |
Sequence | CTTTGGAATGCCAAGGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1027878585_1027878590 | -8 | Left | 1027878585 | 7:83802688-83802710 | CCTGTAATCCCAGCACTTTGGAA | 0: 9594 1: 299194 2: 262940 3: 149017 4: 131705 |
||
Right | 1027878590 | 7:83802703-83802725 | CTTTGGAATGCCAAGGTGGATGG | No data | ||||
1027878583_1027878590 | 11 | Left | 1027878583 | 7:83802669-83802691 | CCAGGTGAGGTGGCTCACACCTG | 0: 248 1: 9285 2: 43027 3: 116113 4: 165275 |
||
Right | 1027878590 | 7:83802703-83802725 | CTTTGGAATGCCAAGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027878590 | Original CRISPR | CTTTGGAATGCCAAGGTGGA TGG | Intergenic | ||
No off target data available for this crispr |