ID: 1027878590

View in Genome Browser
Species Human (GRCh38)
Location 7:83802703-83802725
Sequence CTTTGGAATGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027878585_1027878590 -8 Left 1027878585 7:83802688-83802710 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG No data
1027878583_1027878590 11 Left 1027878583 7:83802669-83802691 CCAGGTGAGGTGGCTCACACCTG 0: 248
1: 9285
2: 43027
3: 116113
4: 165275
Right 1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027878590 Original CRISPR CTTTGGAATGCCAAGGTGGA TGG Intergenic
No off target data available for this crispr