ID: 1027882645

View in Genome Browser
Species Human (GRCh38)
Location 7:83861051-83861073
Sequence GGTCATCATGAATATGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027882645_1027882650 2 Left 1027882645 7:83861051-83861073 CCCTGTCCATATTCATGATGACC No data
Right 1027882650 7:83861076-83861098 AGTGCCATGTCCTTTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027882645 Original CRISPR GGTCATCATGAATATGGACA GGG (reversed) Intergenic
No off target data available for this crispr