ID: 1027882668

View in Genome Browser
Species Human (GRCh38)
Location 7:83861246-83861268
Sequence TTTACCATGTAAAACATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027882666_1027882668 24 Left 1027882666 7:83861199-83861221 CCATTCTTTTTTCAAATTTCACA No data
Right 1027882668 7:83861246-83861268 TTTACCATGTAAAACATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027882668 Original CRISPR TTTACCATGTAAAACATGAT GGG Intergenic
No off target data available for this crispr