ID: 1027883157 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:83868966-83868988 |
| Sequence | CCATTTATCAAACTCCTACT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1027883152_1027883157 | 6 | Left | 1027883152 | 7:83868937-83868959 | CCTGAATTTTGGAGAAAAGAAAC | No data | ||
| Right | 1027883157 | 7:83868966-83868988 | CCATTTATCAAACTCCTACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1027883157 | Original CRISPR | CCATTTATCAAACTCCTACT GGG | Intergenic | ||