ID: 1027883157

View in Genome Browser
Species Human (GRCh38)
Location 7:83868966-83868988
Sequence CCATTTATCAAACTCCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027883152_1027883157 6 Left 1027883152 7:83868937-83868959 CCTGAATTTTGGAGAAAAGAAAC No data
Right 1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027883157 Original CRISPR CCATTTATCAAACTCCTACT GGG Intergenic