ID: 1027893914

View in Genome Browser
Species Human (GRCh38)
Location 7:84015835-84015857
Sequence CAGGGAAATTATACAGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027893910_1027893914 -3 Left 1027893910 7:84015815-84015837 CCACACTTTACTATCCTTTTCAG 0: 1
1: 0
2: 2
3: 16
4: 289
Right 1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG No data
1027893908_1027893914 24 Left 1027893908 7:84015788-84015810 CCATGCATTCAAGTATATTTCAC 0: 1
1: 0
2: 3
3: 17
4: 200
Right 1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027893914 Original CRISPR CAGGGAAATTATACAGATTC TGG Intronic
No off target data available for this crispr