ID: 1027894321

View in Genome Browser
Species Human (GRCh38)
Location 7:84021641-84021663
Sequence TTAGTTTACAAGATGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027894321 Original CRISPR TTAGTTTACAAGATGATGGA GGG (reversed) Intronic
900364996 1:2307918-2307940 TTGCTGTACAAGATGCTGGAAGG - Exonic
902172995 1:14628047-14628069 TTTGTTTGCAAGTGGATGGATGG - Intronic
903811676 1:26038210-26038232 TTTGTTTACAAGATGCAAGAGGG - Exonic
905477936 1:38242068-38242090 TTATTTTACAGGATGAAGGGAGG + Intergenic
905590926 1:39162717-39162739 TTACTTTACAAGATGTTGTGGGG + Intronic
908488539 1:64619230-64619252 TTAGTATACTATATGCTGGAGGG + Intronic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
909902471 1:81155123-81155145 ATAGTTTTGAAGATGATGTAAGG + Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910782844 1:90959692-90959714 TTACTTTACCAGGTGATGGAAGG + Intronic
911011068 1:93281449-93281471 TTATTTTACAAGATCATAGGTGG - Intergenic
917595956 1:176529386-176529408 TTAGTTTACTAAAGGCTGGAAGG - Intronic
918236127 1:182582335-182582357 TTAGCAAACAAGATGATGGGAGG + Intronic
921279386 1:213550725-213550747 TGACTTTCCAAAATGATGGATGG + Intergenic
1062839611 10:659894-659916 TTAGTTTCCGAGATGATGAAAGG - Intronic
1065411673 10:25436046-25436068 ATAGTTTCCAGGATGAGGGAAGG + Intronic
1069364312 10:67680961-67680983 TAATTTTAAAATATGATGGAAGG + Intronic
1071502071 10:86211356-86211378 TTACTTTCCCAGCTGATGGATGG - Intronic
1073282920 10:102367839-102367861 ATAGATTACAAGATGCTGGCTGG + Intronic
1075474359 10:122720674-122720696 AAAGTTTACAAGATAATGGAAGG + Intergenic
1076058515 10:127395017-127395039 TAAGTTTGCCAGATGATGGCTGG + Intronic
1076262849 10:129082882-129082904 TTATGTTACAAAATGATGCATGG - Intergenic
1081481242 11:43491336-43491358 ATAGAGTACAAAATGATGGATGG - Intronic
1085005594 11:73086110-73086132 TTATTTTACAAGATGAGGCTGGG + Intronic
1086476190 11:87177439-87177461 TAAGTTTCCAAGATTATAGAAGG - Intronic
1088248333 11:107840739-107840761 TTACTTTACAGAATCATGGAGGG - Intronic
1090604646 11:128408671-128408693 TTAGTTCACAAGTTGGAGGAGGG + Intergenic
1090688235 11:129149062-129149084 TTAGTTTGTCAGGTGATGGATGG - Intronic
1094082852 12:26556597-26556619 TTTGTTTATAAGATAAGGGACGG + Intronic
1094364480 12:29665546-29665568 TTAGTTCTCAAGATTATGGGTGG - Intronic
1098185432 12:67891448-67891470 TTAATGTAGAAGATGAAGGATGG - Intergenic
1098599084 12:72308097-72308119 CTAGTTTACATCATTATGGAGGG + Intronic
1100539239 12:95542325-95542347 TTAGGTTAAAAGATGATGTTTGG - Intronic
1105226762 13:18442140-18442162 TTAGATTACAGGTTGATAGATGG + Intergenic
1105238242 13:18582492-18582514 TTATTTTACAGGATCATAGATGG - Intergenic
1106829854 13:33568421-33568443 TTTGTTAACAAAATGCTGGAAGG + Intergenic
1108288275 13:48930510-48930532 TTAGATTCCAAGATGATGGGTGG - Intergenic
1110838070 13:80107852-80107874 TTAGTTTACAGGATGGTACAAGG + Intergenic
1111227023 13:85288068-85288090 TTATTTTACAGGCTCATGGATGG - Intergenic
1111546874 13:89749351-89749373 TTATTTCACAAGAAGATGTATGG - Intergenic
1112169360 13:96954168-96954190 TTGGCTTACTAGATGATAGATGG + Intergenic
1112355272 13:98669451-98669473 TAACTTTACAAGTTGATTGAGGG + Intergenic
1112964473 13:105170134-105170156 TTTGTTTACAAGGTGATAAAGGG + Intergenic
1114357883 14:21933557-21933579 TTATTTCACAAGATTATGCAAGG - Intergenic
1116859396 14:49981656-49981678 TTGGTCTAACAGATGATGGAAGG - Intergenic
1117269855 14:54132261-54132283 TTTGTTTAAAAGATAATGAAGGG - Intergenic
1117397492 14:55325456-55325478 TTAGTTTACAAGAAAAAAGAAGG - Intronic
1118790533 14:69087762-69087784 TTATTTTAAAAGATGGAGGAAGG + Intronic
1121914226 14:97821215-97821237 TTATTTTACAAGATCATAGGAGG + Intergenic
1123214158 14:106791097-106791119 TTATTTTACAAGGTGATTTATGG - Intergenic
1125295084 15:38194021-38194043 TTATTTTACAAGGCAATGGAAGG + Intergenic
1125877083 15:43158545-43158567 TTAGGTGAAAAGATAATGGAGGG - Intronic
1126390868 15:48150289-48150311 TGAGGCTAAAAGATGATGGAAGG + Intronic
1126604763 15:50464881-50464903 TTAGTTTACAAGATAATAAATGG + Intronic
1127580694 15:60336921-60336943 TTAGTTTAAAAAATGATGCCGGG + Intergenic
1132352242 15:101147116-101147138 TCAGTTTAATAGATGATGGGTGG - Intergenic
1134251682 16:12578551-12578573 CTAGCTTAGAAGATGGTGGAAGG + Intergenic
1135714416 16:24749300-24749322 TTACTTTACAGTGTGATGGAGGG + Intronic
1138830530 16:60369189-60369211 CAAGTTTACAAGATGAAAGAGGG + Intergenic
1139499060 16:67345835-67345857 TTAATTTACAAGAAGAAGGGAGG - Intronic
1140180181 16:72708515-72708537 TTAGTTTAAAATATGGTGGCTGG - Intergenic
1143925433 17:10365347-10365369 TTAAATAACAAGATGATGGGAGG + Intronic
1147286522 17:39406801-39406823 TTAGGGTTCAAAATGATGGAAGG - Exonic
1153358806 18:4170067-4170089 GTTGTTTCCACGATGATGGAAGG + Intronic
1153442509 18:5136054-5136076 CTACTTTACAAAATGATGGAGGG + Intergenic
1154511635 18:15110333-15110355 TTATTTTACAGGATCATAGATGG - Intergenic
1154526621 18:15297334-15297356 TTAGATTACAGGTTGATAGATGG - Intergenic
1155668844 18:28344958-28344980 TTAGTGTTAAAGATGATGGATGG + Intergenic
1156153925 18:34279325-34279347 CTAGCTTTGAAGATGATGGAAGG + Intergenic
1156711174 18:39947808-39947830 TCAATTTAGAAGATGGTGGATGG + Intergenic
1157004411 18:43564586-43564608 TTAGGTTACAAGATGCTAAAGGG + Intergenic
1157137369 18:45069834-45069856 TCAGTCTACAAATTGATGGATGG + Intergenic
1158035156 18:53019721-53019743 TTATTTTAAAAAATGATGCATGG - Intronic
1159496570 18:69215159-69215181 ATATTTTACAGAATGATGGATGG - Intergenic
1159621801 18:70647896-70647918 TTATTTTTCAAGATCATGTAAGG + Intronic
1159959727 18:74546165-74546187 TTACGTTTCTAGATGATGGAAGG + Intronic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1162617981 19:11816950-11816972 TTAGTTTACAGGTTGAAGGCTGG + Intronic
1163070939 19:14840860-14840882 TTTGTTAATAAGATGGTGGAAGG - Intergenic
1164732953 19:30519700-30519722 TTAGATTGCATGATCATGGAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165482122 19:36070426-36070448 TTAGTTTAAAAGTTTATGGCCGG - Intronic
1165801500 19:38553776-38553798 TTCATTTAAAAAATGATGGAAGG - Intronic
928955144 2:36858456-36858478 TTATCTTACTATATGATGGATGG + Intronic
931934860 2:67185844-67185866 TTATTTTAAAAGATGATGCCAGG - Intergenic
932349337 2:71019674-71019696 TTAGTTTCCATGATCCTGGAGGG - Intergenic
933448556 2:82415003-82415025 ATAGTCTTCAAGATGATGCAAGG - Intergenic
935432079 2:102987054-102987076 TTTGTTTACAATATCATTGAGGG - Intergenic
938511206 2:131947051-131947073 TTATTTTACAGGATCATAGATGG - Intergenic
938525716 2:132128699-132128721 TTAGATTACAGGTTGATAGATGG - Intergenic
939364435 2:141214154-141214176 TTAATTTACAAGATTAAGGATGG + Intronic
939737038 2:145859551-145859573 TTAGTATATAAGATAATGTATGG - Intergenic
940263721 2:151814441-151814463 CTAGTTTACAACATGAGTGAGGG + Intronic
941415069 2:165210184-165210206 GTAGTTTTCCAGATGTTGGAGGG - Intergenic
941534825 2:166709018-166709040 TTAGTTTCCCAGAAGATAGACGG + Intergenic
941866034 2:170335874-170335896 CCAGTTTCCAAGATGATAGAGGG + Intronic
941868138 2:170355902-170355924 TTTTTTTACTAGATGATGTAAGG + Intronic
942655023 2:178206479-178206501 TTGGTTTTCAAGATGAAGAAAGG + Intronic
943461884 2:188179367-188179389 TTTGTTTACAAGAATAAGGAAGG + Intergenic
944125003 2:196282933-196282955 TTGGTTTACAAAATGAAGGATGG + Intronic
945205663 2:207329297-207329319 AGAGTTTACGAGATGCTGGATGG + Intergenic
945980354 2:216305146-216305168 TTAGATTACAAGCTGCAGGAGGG + Intronic
946093556 2:217251868-217251890 TTAGGTTACAAGATTCTAGAAGG - Intergenic
947805112 2:232961142-232961164 TCAGTTTTCAAGATGTGGGATGG - Intronic
948038233 2:234877121-234877143 TGAGTCTAAAAGATGCTGGAAGG - Intergenic
1176770812 21:13071164-13071186 TTAGATTACAGGTTGATAGATGG + Intergenic
1176782230 21:13210769-13210791 TTATTTTACAGGATCATAGATGG - Intergenic
1176934768 21:14853802-14853824 TTAGCTTTGAAGATGAAGGAAGG + Intergenic
1177980262 21:27904874-27904896 TTATTTTACAGGATCATAGATGG + Intergenic
1180517950 22:16165599-16165621 TTAGATTACAGGTTGATAGATGG + Intergenic
1184715290 22:46278542-46278564 TCAGAATACAAAATGATGGATGG - Intronic
952204208 3:31163300-31163322 TATGTTTACAAAATGATGCACGG + Intergenic
952999312 3:38917503-38917525 TTACTTTGCAAGAACATGGATGG + Intronic
954587898 3:51752673-51752695 TTTGTTTCCATGATGATGGAAGG - Intergenic
956323765 3:68027730-68027752 AAAGTTTCCAAGAAGATGGAAGG - Intronic
957199661 3:77116379-77116401 TTAGTTTACTTGATGACTGAAGG + Intronic
958713270 3:97744686-97744708 TTAGTATAAAAGGTCATGGAAGG - Intronic
960704897 3:120472542-120472564 TTAGTTTTGAAGATGGTGGGAGG + Intergenic
963628266 3:147701189-147701211 TAAGTTTAGAAAAGGATGGATGG - Intergenic
964023298 3:152041268-152041290 CTTGTTTCCATGATGATGGAAGG - Intergenic
964498392 3:157320246-157320268 TAAGTTTATGAGATAATGGAGGG + Intronic
964682182 3:159353887-159353909 TTTGTTTACAATAGGATAGAAGG - Intronic
965077872 3:164002458-164002480 TTAGTTCCCAGGTTGATGGAAGG - Intergenic
965402556 3:168230084-168230106 TTTGTTTATAAGATGTTAGAGGG - Intergenic
967329097 3:188272681-188272703 ATAGTTTACAAGAAGATTTAGGG + Intronic
968011240 3:195279038-195279060 CTAGGTTACAAGATGATAGGAGG - Exonic
970080042 4:12272377-12272399 TTAGTATTCTAGAAGATGGAAGG - Intergenic
970819971 4:20200198-20200220 TTATTTGGAAAGATGATGGAGGG + Intergenic
973344088 4:49035953-49035975 CTACTTAACAAGATGCTGGAGGG + Intronic
973979590 4:56296820-56296842 TTAGTTTCCAAGATCAAGTAGGG + Intronic
975369937 4:73573433-73573455 TTATTTTAAAAGATGAAAGAGGG - Exonic
976316134 4:83660947-83660969 TTAGTTTAAAAGGAGATGAAAGG - Intergenic
976685596 4:87811215-87811237 TTAATTTACAAAATGATTGGGGG - Intronic
977881625 4:102211242-102211264 TTAGTCTCCAGGATGATGGGAGG - Intergenic
978116075 4:105022000-105022022 TTTATTTAAAAGATGATTGAAGG + Intergenic
978674739 4:111298845-111298867 TAAACTAACAAGATGATGGATGG - Intergenic
979133710 4:117082204-117082226 TTAGTTCACAAGAGGAAGCAAGG - Intergenic
983666721 4:170191606-170191628 TTAGTATACAAGTTGAGGTAGGG + Intergenic
984503751 4:180591082-180591104 TTATTTTCTAAGGTGATGGACGG - Intergenic
985048208 4:185963044-185963066 TTAGTTTACAAGATCATCTCTGG + Intergenic
987766026 5:22230778-22230800 TTAATCTCCAAGATGATGCATGG + Intronic
989109325 5:37891788-37891810 TTAATTTCTAAGAAGATGGAGGG + Intergenic
989495567 5:42107838-42107860 TAGGTTACCAAGATGATGGAAGG - Intergenic
989547139 5:42687803-42687825 TAAGTTTACAATATGATTGAAGG + Intronic
990240785 5:53814379-53814401 TGTGTTTACAAGATGTTGAAGGG - Intergenic
991449351 5:66735447-66735469 TTGGTATACAATAAGATGGAAGG + Intronic
994750937 5:103736137-103736159 TTGGTTTTGAAGATGAAGGAAGG - Intergenic
994784913 5:104145850-104145872 TTAATTTACAAGAACTTGGAAGG - Intergenic
994998052 5:107090023-107090045 ATGTTTTACAAGCTGATGGAGGG - Intergenic
995289817 5:110438845-110438867 TTAGTTTCCAGGATGATCCATGG - Intronic
996509434 5:124302401-124302423 TTAGTCTACAAGATAATGAATGG - Intergenic
996849248 5:127934158-127934180 TTAGTTGAGATCATGATGGAAGG - Intergenic
997119053 5:131155720-131155742 TTAGTTGACAAGATGCAGAAAGG - Intergenic
998857598 5:146408707-146408729 TTTATTTAAAAGATGTTGGATGG + Intergenic
999595092 5:153194341-153194363 TTTGTTTAGAAGATGAAGAATGG - Intergenic
1000485951 5:161844696-161844718 ATAGTTTACAAAATAATGTAGGG - Intergenic
1000554321 5:162706067-162706089 TTAAATGACAAGATCATGGAAGG + Intergenic
1002469255 5:179425411-179425433 TTCCTTTACAAGGTGAAGGAAGG + Intergenic
1003768965 6:9275612-9275634 TTAGCTTACATGTTTATGGAGGG + Intergenic
1005715134 6:28539968-28539990 TTAGTTTACAAAATCAGGCAAGG - Intergenic
1010509341 6:76699041-76699063 TTAGTGTGCAAGATTTTGGATGG + Intergenic
1012589741 6:100966813-100966835 CTAGTTTACTAGATGATTGTGGG - Intergenic
1013279811 6:108625547-108625569 ATGGTTAAAAAGATGATGGAAGG + Intronic
1016193402 6:141299445-141299467 ATAGTTTACAAAAGAATGGAGGG - Intergenic
1017289635 6:152720902-152720924 TTAGTTTACAAGAGGCAGTAAGG + Intronic
1020682965 7:11259359-11259381 CTAATTTACAAGATGGTGGCAGG - Intergenic
1020867469 7:13585400-13585422 TCAGTTTACAAGAAGATGCTTGG + Intergenic
1021466597 7:20951297-20951319 TTTGTTTTCAAGATGGTGGGAGG + Intergenic
1021638148 7:22711571-22711593 TTATTTTATAAGATAATGAAAGG + Intergenic
1022109897 7:27222305-27222327 TTTGTTTTCGTGATGATGGAAGG + Intergenic
1022910519 7:34896109-34896131 TTATTTTACAGGATCATAGATGG + Intergenic
1023089412 7:36603682-36603704 TTAGTTTACAAAAGCAGGGAGGG + Intronic
1025186485 7:56864045-56864067 ATATTTTACAACATGATGGGTGG + Intergenic
1025685437 7:63712851-63712873 ATATTTTACAACATGATGGGTGG - Intergenic
1026667231 7:72352676-72352698 TTACTTTACAAAAAGATGAAAGG + Intronic
1027855573 7:83507151-83507173 ATATTTGACTAGATGATGGATGG - Intronic
1027894321 7:84021641-84021663 TTAGTTTACAAGATGATGGAGGG - Intronic
1028857889 7:95612438-95612460 TAAATCTACAAGATGCTGGAAGG - Intergenic
1030427161 7:109393084-109393106 TTAATTAACAAGCAGATGGAGGG + Intergenic
1030879188 7:114855006-114855028 TTAGTTTATGAGATGGAGGAAGG + Intergenic
1036098420 8:5750726-5750748 TCAGCTCACAAGAGGATGGATGG + Intergenic
1037387468 8:18358820-18358842 TTGATTTAGAAGATGATGTAAGG + Intergenic
1038239015 8:25791111-25791133 TTGGTTTTCCACATGATGGAAGG - Intergenic
1039599789 8:38825993-38826015 TTAGTTTATACGGTCATGGATGG - Intronic
1042105708 8:65324138-65324160 GTAGTTTACAAGATCTGGGATGG + Intergenic
1042964255 8:74334226-74334248 TTAGATTGCAAGATCAGGGAAGG + Intronic
1044302493 8:90602172-90602194 TTAATTAACAAAATGATGCAAGG - Intergenic
1044719224 8:95129692-95129714 TTATTTTAGGAAATGATGGAAGG + Intergenic
1045823482 8:106369567-106369589 TTTTTTTATAAGATGACGGAAGG + Intronic
1045865078 8:106855827-106855849 TTAGTATCCAAGATTAGGGAAGG - Intergenic
1046484037 8:114861814-114861836 TTAGTTGTCATGATGAGGGAGGG - Intergenic
1047849587 8:128842236-128842258 TTAGCTTATATGATTATGGATGG - Intergenic
1049146458 8:141004330-141004352 ATAATTTGCATGATGATGGAGGG + Intergenic
1050610994 9:7353611-7353633 GTAGTTTACAAGAGGTTGGTGGG - Intergenic
1050978642 9:11977737-11977759 TTAAGTGACTAGATGATGGAGGG - Intergenic
1052481200 9:29028711-29028733 TTAGCTTGCTAGATGATGAAAGG + Intergenic
1053198672 9:36138084-36138106 TTAGTTAACAGGATGACAGATGG + Intronic
1053704425 9:40736129-40736151 TTAGATTACAGGTTGATAGATGG - Intergenic
1053803099 9:41776337-41776359 TTGGTTTACAACCTGATGGAGGG - Intergenic
1054142167 9:61538785-61538807 TTGGTTTACAACCTGATGGAGGG + Intergenic
1054191389 9:61987647-61987669 TTGGTTTACAACCTGATGGAGGG - Intergenic
1054414510 9:64859739-64859761 TTAGATTACAGGTTGATAGATGG - Intergenic
1054461920 9:65469970-65469992 TTGGTTTACAACCTGATGGAGGG + Intergenic
1054646980 9:67600070-67600092 TTGGTTTACAACCTGATGGAGGG + Intergenic
1054950339 9:70843752-70843774 TCAGTTTACAAGATGTTAGGCGG + Intronic
1055278635 9:74648700-74648722 TTTGTTTTCAGGAGGATGGACGG - Intronic
1056127414 9:83549255-83549277 ATATTTTACAAGAATATGGATGG - Intergenic
1056312945 9:85359373-85359395 TTTTTTTCCAAGATGGTGGACGG - Intergenic
1057510167 9:95671745-95671767 GAAGCTTACAAGAAGATGGAAGG + Intergenic
1059107322 9:111522907-111522929 GTGGTTTAAAAGGTGATGGAAGG - Intergenic
1059186861 9:112282090-112282112 TTAGATTACATGATGAAGGTGGG - Intronic
1059741416 9:117154033-117154055 TTAGTTTCAAAGAAGATGGGTGG - Intronic
1061285171 9:129618589-129618611 TGGGTTTACAAGTGGATGGAAGG + Intronic
1186010103 X:5120754-5120776 TTACTTGACAAGATCATGCATGG - Intergenic
1188711042 X:33398305-33398327 TAAGTGTAAAAGATGATGTAAGG + Intergenic
1190536810 X:51437067-51437089 TGAGGTTACAAGATCATGCATGG - Intergenic
1190791247 X:53702554-53702576 TTAGTTAACAGGATGAAGAAGGG - Intergenic
1198913883 X:141644643-141644665 TGATTTTCCAACATGATGGAAGG + Intronic
1199395449 X:147331876-147331898 TTAGATTACATGGTGATAGAGGG + Intergenic
1200701372 Y:6405409-6405431 TGAAATTCCAAGATGATGGAGGG + Intergenic
1201032739 Y:9759289-9759311 TGAAATTCCAAGATGATGGAGGG - Intergenic