ID: 1027906015

View in Genome Browser
Species Human (GRCh38)
Location 7:84183219-84183241
Sequence TAGGTGTGAGGACTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027906015 Original CRISPR TAGGTGTGAGGACTGCAGCA TGG (reversed) Intronic
900109827 1:1000665-1000687 CAGGTGTGCGGCCTGGAGCACGG + Intergenic
900659460 1:3775406-3775428 TAGGTGGGAGGACGGCAGCAGGG + Exonic
901089109 1:6629670-6629692 TGGGTGTGGGGCCTGAAGCAGGG - Intronic
901419306 1:9139688-9139710 TCAGTGTGAGGACTTCAGCTTGG + Intergenic
902622763 1:17660083-17660105 GAGGTGTCAGGCATGCAGCAGGG + Intronic
904454100 1:30636564-30636586 AAGGTATGAGGGCTGCTGCAGGG + Intergenic
904529491 1:31158893-31158915 GAGGTGAGAGGATTGGAGCAGGG + Intergenic
904693961 1:32316849-32316871 GAGGTGCGAGGACGGCAGAATGG - Intronic
906491922 1:46275121-46275143 GAGGATAGAGGACTGCAGCAAGG - Intronic
907785967 1:57612974-57612996 TAGGTGTGTGGACAGCAATAAGG - Intronic
908198058 1:61765306-61765328 AAGGTGGGAGGACTGCTTCAGGG - Intronic
910486667 1:87722370-87722392 TTGGTGTCGGGACAGCAGCAGGG + Intergenic
913075835 1:115339419-115339441 TAGGTGTGAGGAGAGTAACAGGG + Intergenic
913211898 1:116589227-116589249 TCAGTGTGAGGAAGGCAGCACGG + Intronic
917067573 1:171113400-171113422 AAGGTGTGAGAGCTGCAGCTGGG - Intronic
917124666 1:171676373-171676395 TAGTTCTCATGACTGCAGCAAGG + Intergenic
917330703 1:173877653-173877675 AAGGTGGGAGGACTGCACCTTGG - Intronic
917600551 1:176569702-176569724 TAGGTGCTAGGAAGGCAGCAAGG - Intronic
917901840 1:179550652-179550674 TAGGTGTGAGGAATTCAGGGTGG + Exonic
918135170 1:181666328-181666350 TAGATGTTAGGAATACAGCAGGG + Intronic
919288609 1:195599507-195599529 TAAAAGTGAGGACTGCAACATGG + Intergenic
919916499 1:202142887-202142909 TAGGTCTGAGAAATGCAGCTGGG - Intronic
920446945 1:206024833-206024855 TAGGTGTTAGGACATCAACATGG + Intergenic
920963265 1:210682465-210682487 TGTGTGTGAGGCCAGCAGCATGG + Exonic
924089214 1:240485571-240485593 TAGGTGTGGGGGCTGGAGCATGG - Intergenic
924282206 1:242449760-242449782 GAGGTGTGTGGACACCAGCACGG - Intronic
924820532 1:247485594-247485616 TTCGTGTGAGGTCTGCAGCTCGG - Intergenic
1063010163 10:2013938-2013960 TGGGGGTGAGGACTTCAACATGG - Intergenic
1063121213 10:3106667-3106689 TAGGGGTGAGGACAGGGGCAGGG - Intronic
1063710204 10:8469961-8469983 TATGAGTGAGAACAGCAGCATGG - Intergenic
1063711033 10:8478884-8478906 TGGGTGTGAGGTGGGCAGCATGG + Intergenic
1064029722 10:11876105-11876127 TGAGTGTGAGGATGGCAGCAAGG + Intergenic
1064626338 10:17265825-17265847 TACTTGTGTAGACTGCAGCATGG + Intergenic
1067090507 10:43263927-43263949 CAGGTGTGAGGACTCAAGCGGGG - Intronic
1067509280 10:46881969-46881991 CTGGTGTGAGCACTGCAGCATGG - Intergenic
1067652972 10:48169886-48169908 CTGGTGTGAGCACTGCAGCATGG + Intronic
1068717902 10:60208469-60208491 TAGAAGTGAGAATTGCAGCATGG + Intronic
1072151507 10:92688948-92688970 GAGGTGTGACGACCGCAGGAGGG + Intergenic
1073451027 10:103609263-103609285 TAGGGGTGAGGGCTGCAGGTGGG + Intronic
1074102556 10:110365045-110365067 TAGAGATGAGGTCTGCAGCAAGG + Intergenic
1075525274 10:123179155-123179177 TTCATGTGAGAACTGCAGCATGG + Intergenic
1076786742 10:132753584-132753606 TAGCTGTCAGGGCTGCAGGATGG + Intronic
1076827804 10:132978448-132978470 TAGGTGTGAGGATGGTACCATGG + Intergenic
1077848337 11:6049630-6049652 TAGGTCAGAGGACTGAATCAAGG - Intergenic
1078455755 11:11473611-11473633 TAGGCTTGAGGGCAGCAGCAGGG + Intronic
1083632062 11:64100858-64100880 TGGGGGTGGGGGCTGCAGCAGGG + Intronic
1084540486 11:69783145-69783167 CAGATGAGAGGACTTCAGCAGGG + Intergenic
1084639025 11:70413396-70413418 TCGGTGTCAGGACTGGAGCAGGG + Intronic
1084774470 11:71366292-71366314 GAGGTGAGAGGCCTGCAGCAGGG + Intergenic
1086336848 11:85809762-85809784 GAGGTGTGGGGACGGCAGCAGGG - Intronic
1088716204 11:112551928-112551950 AATGTGGGAGGACTGAAGCAGGG - Intergenic
1090378138 11:126306045-126306067 AAGGTGTGAGAACTGCCACAAGG + Intronic
1091234190 11:134008795-134008817 TAGGTGTCAGGACCTCTGCAAGG + Intergenic
1091726330 12:2848983-2849005 AAGGTGGGAGGACTGCGGCCAGG - Intronic
1093067506 12:14673906-14673928 TAGGACTGAGGGCTGCACCAGGG - Intronic
1094384039 12:29874158-29874180 GTGGTGTGAGGTCTGCAGCCAGG + Intergenic
1094530032 12:31265771-31265793 TAGGTGTCAGATCTGCAGCACGG - Intergenic
1096087135 12:48873092-48873114 AAGGTGGGAGGAATGAAGCAAGG + Intergenic
1096672529 12:53208864-53208886 TAGGTGTGGTGGCTCCAGCAGGG - Intergenic
1097967594 12:65597448-65597470 TAGGGGTTAGGACTTCAACACGG + Intergenic
1102245005 12:111349989-111350011 TTGGTGTGGAGACTGCAGCCTGG - Exonic
1102511405 12:113418055-113418077 TAGGTGTTGGGGCTGCAGTAGGG + Intronic
1102524990 12:113506071-113506093 GAGGGGTGAGGACAGGAGCAGGG - Intergenic
1103612158 12:122130346-122130368 ATGGTGGGAGGACAGCAGCAGGG + Intronic
1104690924 12:130825962-130825984 TAGGTTTGAGAATTTCAGCAGGG + Intronic
1105215149 13:18279853-18279875 TCAGTGTGAGGAAGGCAGCACGG + Intergenic
1107298062 13:38935374-38935396 TAGGTGTGAGCACTACACCCAGG - Intergenic
1107434484 13:40370246-40370268 GAGGTGTCAGGGGTGCAGCAGGG - Intergenic
1110131735 13:72019431-72019453 TGGTTGTGAGGACAGCAGCTAGG - Intergenic
1110839757 13:80128329-80128351 TGTGTGTGAGTACTGCAGGAAGG + Intergenic
1111074872 13:83221004-83221026 AAGGGGTGAGAACTGCAGCAGGG - Intergenic
1113045594 13:106151546-106151568 TGGGTATCAGGACTGCAGCTGGG + Intergenic
1113728933 13:112625848-112625870 TGGGTGTTAGGGCTTCAGCACGG + Intergenic
1116402980 14:44531774-44531796 TAGATGTGAGCAATGAAGCAGGG + Intergenic
1117938193 14:60931304-60931326 TTTGTGTGAGAGCTGCAGCAGGG + Intronic
1119849285 14:77855364-77855386 TAGATGTGAAGACTGAAGTAGGG + Intronic
1120507055 14:85365846-85365868 TGGATGAGAGGACTGGAGCAAGG - Intergenic
1121494378 14:94381793-94381815 TAGCTGTGCTGACTGCAGCCTGG + Intronic
1124047604 15:26164435-26164457 TCTGTGAGAGGACTGGAGCAGGG + Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1127286196 15:57535783-57535805 TGGGGGTGAGGACTGGAGAAGGG + Intronic
1128779826 15:70352012-70352034 TAGGTGTTAGGGATGCAGCAGGG - Intergenic
1128947640 15:71840339-71840361 TGGTTGTGTGGACTGCTGCAAGG + Intronic
1129706738 15:77798670-77798692 TGGCTGTGAGGCCTGCAGCTGGG - Intronic
1133166829 16:3953924-3953946 TTGGTGTGAGGATTGCTGCATGG + Intronic
1133754479 16:8752137-8752159 TAGGTGTGAGGAAATGAGCAGGG - Intronic
1136477978 16:30525251-30525273 CAAATGTGAGGTCTGCAGCAAGG - Exonic
1138736915 16:59261316-59261338 CAAGTGTGAGAACTGGAGCAAGG - Intergenic
1138848552 16:60597684-60597706 TAGGTTTTAGGACAGCAGCCAGG - Intergenic
1139099687 16:63750366-63750388 TAGGTGAGTGGACTCAAGCATGG - Intergenic
1140873440 16:79128029-79128051 TGGATGTGAGGAATGGAGCAGGG + Intronic
1142346181 16:89555462-89555484 CAGGTGGGAGGACTGCCCCATGG - Intronic
1142410257 16:89912426-89912448 AAGGTGTTAGGGCTGCAGCAGGG + Intronic
1143056576 17:4167104-4167126 GAGGTGTCAGGAGTGCAGCTGGG - Exonic
1143571113 17:7759267-7759289 GAGGTGTGAGGACTGAAGGTTGG - Intronic
1144673103 17:17143949-17143971 TAGGCGGCAGGGCTGCAGCAGGG + Intronic
1146462671 17:33058744-33058766 AAGGTGAGATGACTGCATCAGGG - Intronic
1147460364 17:40564401-40564423 GGGGTGTGAGGACAGCACCAGGG + Intronic
1147505153 17:41008893-41008915 TAGGTATCAGGCTTGCAGCAGGG + Exonic
1147934253 17:44002333-44002355 CAGGTGTCAGGACTCCAGCATGG + Intronic
1149031275 17:52085317-52085339 GAGGTGTGAAGACCACAGCAGGG - Intronic
1151424884 17:74024544-74024566 GAGGTTGGAGGATTGCAGCATGG - Intergenic
1152077055 17:78166377-78166399 TTGGTGTGAGGGCTTCAGGAGGG + Intergenic
1155213479 18:23622086-23622108 CAGGTGGGAGGGCTGCTGCATGG + Intronic
1156655408 18:39279671-39279693 TAAGTGAGATGACTGCACCAAGG + Intergenic
1160578581 18:79870975-79870997 CAGGTGTGCTGACTGCAGCGTGG - Intronic
1161055569 19:2189234-2189256 GAGGAGTGAGCACTGCAGAAAGG - Intronic
1163324082 19:16592105-16592127 TAGGGGTCAGGGCTGCAGCTGGG - Intronic
1163386123 19:17001601-17001623 TAGGGGTGAGGACACCAGCATGG + Intronic
1163528663 19:17836749-17836771 GAGGTGTGAGGAGGGCAGCACGG - Intronic
1164278306 19:23744407-23744429 AAGGTGTGAGGACTGCCTAAAGG + Exonic
1164830670 19:31317622-31317644 CAGGTGTGAGGAGAACAGCAGGG + Intronic
1167327074 19:48833241-48833263 TGGGTGTGACGACTGCAGTGTGG - Intronic
925291039 2:2748886-2748908 CACGTGTGAGGACTGCAGCAGGG + Intergenic
925853148 2:8103754-8103776 TTGCTGTGAGCACTGGAGCATGG + Intergenic
927677804 2:25119361-25119383 TGGCTGTGAGGAGTGCAGCCGGG + Intronic
928325371 2:30315382-30315404 AAGGTGTGAGGATTTCAGGATGG + Intronic
928332117 2:30365572-30365594 CTGGTGCGAGGACAGCAGCAAGG - Intergenic
928645948 2:33352833-33352855 TAGGTATGAGGAGTGTAGGACGG - Intronic
929136590 2:38629998-38630020 AAGATGTGAGGACTGAAGCAGGG - Intergenic
929530796 2:42750910-42750932 TAGGGGAGGGGACTGAAGCAAGG - Intronic
932487700 2:72094482-72094504 TAGGGGTGAGGCCTGGTGCAGGG - Intergenic
934299170 2:91766884-91766906 TCAGTGTGAGGAAGGCAGCACGG - Intergenic
934608903 2:95720197-95720219 TAGCTGTGTGTACTGGAGCATGG + Intergenic
934768368 2:96893262-96893284 TGGGTGTGAGGGCTGCAGAGTGG - Intronic
935197107 2:100823582-100823604 TAGCTGTGAGAAATGCAGCTCGG - Intronic
935390552 2:102547958-102547980 TAGGTGTGAGTCCTGCATTATGG - Intergenic
935744147 2:106176178-106176200 GAGGTGGGAGGACTGCAGCCAGG - Intronic
936394524 2:112112046-112112068 TAGGTGTGAGGAAGGAGGCAAGG - Intronic
936983576 2:118287302-118287324 CACGTGTGAGGACTGCAAGAAGG + Intergenic
937059346 2:118970198-118970220 AGGGTGTGCTGACTGCAGCAAGG - Exonic
938127586 2:128685647-128685669 TAGTTCTGGGGCCTGCAGCAAGG + Intergenic
939234745 2:139476950-139476972 TAGTTGTCTGGATTGCAGCAGGG + Intergenic
940733001 2:157415943-157415965 TGTGTCTGAGGACTCCAGCAGGG - Exonic
940773052 2:157858990-157859012 AAGGTGTGGGGAATGCAGTAAGG - Intronic
941323864 2:164088622-164088644 TTGGTGTTAGGAGTGGAGCAGGG + Intergenic
943053813 2:182949863-182949885 TATGTGTTAGGTCTGCAGCAAGG + Intronic
944166769 2:196731039-196731061 TAGTTGTCAGGAATGCAACAGGG + Intronic
944878099 2:203983445-203983467 TTCGTGTGAGGTCTGGAGCAGGG + Intergenic
945267113 2:207901479-207901501 TAGGTGCCAGGACTGGAGCTGGG - Intronic
945463901 2:210144991-210145013 TGGGTGTGAGGACACCAGCTGGG + Intronic
947468951 2:230382300-230382322 GAGGTGGGAGCACTGGAGCAGGG + Intronic
948521467 2:238541375-238541397 TGAGTGTGAGCACTGCACCAGGG - Intergenic
1173579049 20:44133074-44133096 ATGGTGTGATGACTGGAGCAGGG - Intronic
1174650094 20:52117679-52117701 TAAGTTTGAGAAGTGCAGCATGG + Intronic
1174722858 20:52832101-52832123 TAGGTGGGTGGATTGCAGAATGG + Intergenic
1175279490 20:57793671-57793693 TAGGAGAGAGAACGGCAGCATGG - Intergenic
1177588721 21:23133874-23133896 AAGGTGAGAGGAATGAAGCAGGG - Intergenic
1178304884 21:31483112-31483134 TAAGTCTGAGGACTTCAGGAAGG - Intronic
1178698220 21:34812229-34812251 TGGGGGAGAAGACTGCAGCAGGG - Intronic
1179402997 21:41101879-41101901 GAGGAGTGAGGACAACAGCATGG + Intergenic
1181895778 22:26106217-26106239 CAGGTGTGGGGAGAGCAGCAGGG - Intergenic
1183190278 22:36318066-36318088 TTGCTGTGAGGACTGCATCATGG + Intronic
1184518484 22:44978248-44978270 TGGGTGTGAGGAGTGCTGCTGGG - Intronic
951219345 3:20053023-20053045 TAGCTTTGTGGTCTGCAGCAGGG + Intronic
951866960 3:27319445-27319467 GAAGAATGAGGACTGCAGCATGG + Intronic
952556555 3:34538033-34538055 TAGGTCTCAGGCCTGCATCATGG + Intergenic
953717739 3:45330354-45330376 TAGGAGGGAGAACTGGAGCAAGG - Intergenic
953929344 3:46998228-46998250 TAGGTGTGAGGACCTGAGCAAGG + Intronic
954294048 3:49664420-49664442 TAGGTGTGAAGGCTGGAGCCAGG + Exonic
954322622 3:49842373-49842395 CAGTTCTTAGGACTGCAGCAGGG - Intronic
956225866 3:66957462-66957484 TAGGAGCGGTGACTGCAGCAAGG - Intergenic
956491076 3:69772866-69772888 TAGGTATGAGGAATACAGCAGGG + Intronic
957368470 3:79258171-79258193 TAGGTGTAAGAAGTGTAGCAAGG - Intronic
957564075 3:81862780-81862802 CACGTTTGAGGACTGCAGCCTGG + Intergenic
959585723 3:108023411-108023433 TAGGACTGAGGACAGCAGGAAGG - Intergenic
961418623 3:126781585-126781607 GAGGGGTCAGGACTGGAGCAAGG + Intronic
964329818 3:155590051-155590073 TAAGTATGAGTACTGCATCATGG + Intronic
967231282 3:187339532-187339554 TCGGTGTGTGGGCGGCAGCAGGG + Intergenic
968108327 3:196019999-196020021 GCTGTGTCAGGACTGCAGCAGGG + Intergenic
968416758 4:443759-443781 CAGGTGTGAGGAATGCATAAAGG + Exonic
968700883 4:2058063-2058085 CAAGTTTGAGGACTGCAGCGTGG - Intergenic
970726537 4:19052043-19052065 TAGGTCTGAGCTCTGCAGCTGGG + Intergenic
971117438 4:23664536-23664558 AAGCTGTGAGCACTGCTGCATGG + Intergenic
972463650 4:39330553-39330575 CAGGAGTGAGCACTTCAGCAAGG + Intronic
972610327 4:40650321-40650343 GGGGTGTGGGGAGTGCAGCAGGG - Intergenic
976224220 4:82782456-82782478 TTGGTGTGAGGACTAAATCAGGG - Intronic
976850477 4:89539544-89539566 TATGTGTAATGACTGCAGAATGG + Intergenic
978822162 4:112979239-112979261 CAGGTGTGCCGGCTGCAGCAAGG + Intronic
981389425 4:144171286-144171308 TAGTTGTGAGAACTGGAGAATGG + Intergenic
981446793 4:144849369-144849391 TAGGTGTGGTGTCAGCAGCAGGG + Intergenic
983846068 4:172520195-172520217 TCGGTGTCAATACTGCAGCAAGG + Intronic
985470266 5:37666-37688 GCTGTGTCAGGACTGCAGCAGGG + Intergenic
985901886 5:2802817-2802839 TAGGTGTGTGCACTACAGCCAGG - Intergenic
985928419 5:3035628-3035650 CAGCTGTGAGGACAGCAGCCAGG - Intergenic
986280287 5:6316676-6316698 GAGGTCTGTGGGCTGCAGCAAGG + Intergenic
986284456 5:6349133-6349155 TAGGTGAGAAGACTGGAGCCCGG - Intergenic
986495528 5:8338249-8338271 TAGATGTGAGGACCTCAGGAGGG + Intergenic
990109220 5:52303505-52303527 TAAGTGTTAGGTCTTCAGCAAGG + Intergenic
990551063 5:56879150-56879172 TAGGTGTGAGGCTTGCTGCGAGG - Intronic
991674914 5:69081139-69081161 CAAGGTTGAGGACTGCAGCATGG + Intergenic
991695466 5:69266674-69266696 GTGGGGTGAGGACTTCAGCAGGG + Intronic
992985288 5:82222301-82222323 TAGTTGTGAATACTGGAGCAAGG + Intronic
994058768 5:95449697-95449719 TAGGAGGGAGGAGGGCAGCAGGG + Intronic
995969548 5:117951772-117951794 TAGGGAAGAGGACTTCAGCATGG - Intergenic
997014581 5:129917851-129917873 TACAGGTGAGGCCTGCAGCATGG + Intronic
997476223 5:134144138-134144160 TAGGAAGGAGGCCTGCAGCAGGG - Intronic
1001706411 5:173744265-173744287 TGGGTGTAAGCACTGCAGGAAGG - Intergenic
1002929481 6:1623653-1623675 TTGGTGGGAGGACTCCTGCAAGG - Intergenic
1003118630 6:3300898-3300920 CAGGTGTGTGGAATGCAGGAGGG + Intronic
1006933676 6:37702786-37702808 TAGATGTGAAGACTGAGGCAAGG + Intergenic
1007603955 6:43102888-43102910 GAGGTGGGAGGATTGCAGCTTGG + Intronic
1012390468 6:98732239-98732261 TTGGTGTTTGGACTCCAGCAAGG - Intergenic
1013818082 6:114122754-114122776 AAAGTGTGAGGACAGAAGCAAGG + Intronic
1014160331 6:118160642-118160664 TAAGTGCGAAGACTGAAGCAAGG + Intronic
1019401620 7:857266-857288 CAGGTGTGAGAGCTGGAGCACGG + Intronic
1019422395 7:957124-957146 GAGGTGTGTGGCCTCCAGCAAGG - Intronic
1021731519 7:23599734-23599756 TAGGTGTGAGCCCTGGAGCCCGG + Intronic
1022140536 7:27489305-27489327 TAGGTGTGACCACAGCAGCATGG + Intergenic
1024724345 7:52175835-52175857 TAGGTGAGTGGAATGGAGCATGG + Intergenic
1027906015 7:84183219-84183241 TAGGTGTGAGGACTGCAGCATGG - Intronic
1030084638 7:105805994-105806016 GAGGTGAGAGGGCTGCTGCAGGG + Intronic
1030685486 7:112482497-112482519 TAGGTGTGGTAACTGAAGCATGG - Intronic
1035122177 7:156578065-156578087 TAAGTGTGAGGACTGTAAGACGG - Intergenic
1035887447 8:3307313-3307335 TAGGTGTGAGGGCCTCAGCTGGG - Intronic
1037161540 8:15779297-15779319 CAGGTGGGAGGACTGCTACATGG - Intergenic
1040964394 8:53070077-53070099 TAGGTGAGAGATGTGCAGCATGG - Intergenic
1045333860 8:101180687-101180709 CAGGTGTGAGAACTACAACAGGG + Intronic
1045352346 8:101353212-101353234 CAGGTGGCAGGACTGCAGCTTGG + Intergenic
1045556956 8:103223951-103223973 TAGCTTTGAGGACTGGGGCATGG - Intronic
1045651507 8:104345938-104345960 AAGGTGTGATGCCTCCAGCAGGG + Intronic
1046526192 8:115384978-115385000 AAGGTGTTATGACTGAAGCAAGG + Intergenic
1046999422 8:120558901-120558923 TAGGTGCTAGGAATACAGCAGGG - Intronic
1047277639 8:123417598-123417620 TAGGTATGAGGACTAAGGCAAGG - Intronic
1047324468 8:123823464-123823486 TTGGGGTGAGGACTCCGGCAAGG + Intergenic
1049475287 8:142794399-142794421 AAGGAGTGAGGACTGCAGGGCGG - Intergenic
1051585178 9:18719846-18719868 TACGTGGGAGGAGAGCAGCATGG + Intronic
1054736782 9:68761088-68761110 TAGCTGTGAGGCCTGGAGTATGG + Intronic
1057582949 9:96303611-96303633 TGGGTGTGACAACTGAAGCAAGG + Intergenic
1057678042 9:97151346-97151368 TGATTGTGAGGACAGCAGCAAGG + Intergenic
1058674338 9:107387814-107387836 TAGGGGTGAGGACGGTAGCCAGG + Intergenic
1186374357 X:8982244-8982266 CAGTAGTGAGGACAGCAGCAAGG - Intergenic
1186928841 X:14364888-14364910 TAGGTGGGAGCAATGCAGCTGGG - Intergenic
1193969920 X:88038849-88038871 TGGGTGTGTGGGATGCAGCATGG - Intergenic
1194820066 X:98494656-98494678 TAGGTGCTAGGGCTACAGCAAGG + Intergenic
1194939943 X:99997631-99997653 TAGGTGTCAGGTCTGCAATATGG - Intergenic
1197252709 X:124232096-124232118 TAGGTGGGAGGACTTCAGAGAGG - Intronic
1198644731 X:138793627-138793649 TACGTGTGAGGGCTTCAGCTAGG + Intronic
1198847631 X:140929740-140929762 TAGGGGCGAGGGGTGCAGCATGG - Intergenic
1201797660 Y:17916618-17916640 TATGTGTGATGACAGCACCATGG + Intergenic
1201803893 Y:17989339-17989361 TATGTGTGATGACAGCACCATGG - Intergenic
1202359002 Y:24085355-24085377 TATGTGTGATGACAGCACCATGG + Intergenic
1202511776 Y:25584759-25584781 TATGTGTGATGACAGCACCATGG - Intergenic