ID: 1027908224

View in Genome Browser
Species Human (GRCh38)
Location 7:84213830-84213852
Sequence TGAAAGTACTATTTGGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027908224_1027908228 -7 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908228 7:84213846-84213868 ACTTTCATTTCTAAAAAGGGAGG No data
1027908224_1027908227 -10 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908227 7:84213843-84213865 AGTACTTTCATTTCTAAAAAGGG No data
1027908224_1027908234 28 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908234 7:84213881-84213903 TATCATGGAAATAGAGGCATTGG 0: 1
1: 0
2: 1
3: 31
4: 342
1027908224_1027908229 13 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG 0: 1
1: 0
2: 0
3: 9
4: 77
1027908224_1027908233 22 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908233 7:84213875-84213897 CAGCACTATCATGGAAATAGAGG 0: 1
1: 0
2: 0
3: 11
4: 128
1027908224_1027908235 29 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908235 7:84213882-84213904 ATCATGGAAATAGAGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027908224 Original CRISPR TGAAAGTACTATTTGGTACT AGG (reversed) Intronic
905782894 1:40728246-40728268 TGAAATTACTCTTTGGTCCATGG + Intronic
907715542 1:56922881-56922903 GCTAAATACTATTTGGTACTGGG - Intergenic
909250502 1:73347710-73347732 TGCATGTACTATTTAGTACATGG - Intergenic
909250509 1:73347796-73347818 TGCATGTACTATTTAGTACATGG - Intergenic
909259752 1:73472055-73472077 TGAAAGTAAAATTTGTTTCTTGG - Intergenic
910713052 1:90201803-90201825 TCAAAGTACTATTTGTTGCTGGG + Intergenic
911291350 1:96060040-96060062 TGACAGTAATAGTTGGTACTTGG - Intergenic
913411348 1:118555320-118555342 TAAAATAACTATTGGGTACTGGG + Intergenic
916798989 1:168196661-168196683 TGAATATACTAATTGATACTGGG + Intronic
917253555 1:173089293-173089315 TAAAATAACTATTGGGTACTAGG - Intergenic
918863190 1:189859983-189860005 TCAAAGTACTCTGTGGTAGTGGG + Intergenic
922282245 1:224137227-224137249 TTAAAGTAATAGTTGGGACTGGG + Intronic
923736269 1:236611105-236611127 TGAATTAACTATTTGGTCCTGGG - Intergenic
1065238036 10:23674397-23674419 TGAAGGTATTATTTGCTGCTGGG + Intergenic
1066686168 10:37983603-37983625 TGAAAGTATTATTTGGGAACTGG + Intergenic
1068200850 10:53782532-53782554 TGAAAGTACTTTTTTTTAATGGG + Intergenic
1069618463 10:69821291-69821313 TGAAAGGCCTATTTGGCCCTGGG + Intronic
1070316860 10:75322036-75322058 TAAAAGTACTATTTCGTATTGGG - Intergenic
1071885458 10:89944896-89944918 TGATAGAACCATTTTGTACTTGG - Intergenic
1072275567 10:93819441-93819463 AGAAAGAACTATTTGAGACTTGG + Intergenic
1073821227 10:107266667-107266689 TGAAATTGGTATTTAGTACTTGG + Intergenic
1075625073 10:123958170-123958192 AGAAAGGACTATTTGGAAATTGG - Intergenic
1078212517 11:9281660-9281682 TGAAAGTGCTTTTTGCTGCTTGG - Exonic
1081271882 11:41095050-41095072 TGAAAATACTATCTGAGACTGGG + Intronic
1082062997 11:47876460-47876482 TGAAAGTATTATTTGGGAACGGG + Intergenic
1083195876 11:61086976-61086998 TAAAAATAATATTTGGTACTTGG - Intergenic
1085379433 11:76100717-76100739 AAAAAGTACTATTGGGTACTAGG - Intronic
1085947109 11:81285035-81285057 TGAAAGTATTATTTGGGAACTGG - Intergenic
1086167686 11:83798352-83798374 TTAAAATAATATTTGGTACATGG + Intronic
1086782929 11:90929962-90929984 TCAAAGTACTATCTGGTCCCAGG - Intergenic
1086815120 11:91360575-91360597 TGTAAGTACTATATTGTACAGGG + Intergenic
1091060872 11:132461104-132461126 TGAAATAAGTATTTGGTATTTGG + Intronic
1093680011 12:21991496-21991518 TGAAATTACTTTTTGGTAGCTGG - Intergenic
1095252867 12:39999053-39999075 TGAAAGTATTATTTGGGAACTGG - Intronic
1096163861 12:49403906-49403928 GTAAAGTACTATTTGGAAGTAGG + Intronic
1097664360 12:62463022-62463044 TGAAAGTATTATTTGGGAACTGG - Intergenic
1104330497 12:127839927-127839949 AAAAAGAACTATTGGGTACTAGG + Intergenic
1105409396 13:20159299-20159321 TGTAAGTACTACATAGTACTGGG + Intronic
1107074399 13:36306306-36306328 TGACAGTAGTATTTGTTACTGGG - Intronic
1107116093 13:36747341-36747363 AAAAATAACTATTTGGTACTAGG - Intergenic
1108083409 13:46760653-46760675 TGAAAATACTTTTTGGTCATGGG + Intergenic
1108165747 13:47691500-47691522 CAAAAGTACTAATTAGTACTAGG + Intergenic
1109461836 13:62670399-62670421 TAGAAATACTATTTGGGACTGGG + Intergenic
1110204072 13:72890464-72890486 TTAAAGTAGTATTTGGTATATGG + Intronic
1113068651 13:106396467-106396489 AAAAATAACTATTTGGTACTGGG - Intergenic
1114202739 14:20538254-20538276 AAAAATTACTATTGGGTACTAGG - Intergenic
1114760277 14:25306590-25306612 AAAAATAACTATTTGGTACTAGG + Intergenic
1117877086 14:60263689-60263711 TGAAAGTAATATTTCTTTCTTGG + Intronic
1117973279 14:61273009-61273031 TTAAAGTAATATATGTTACTGGG - Intronic
1118118168 14:62805155-62805177 TGAAAGTCCTATGTGGTAAATGG - Intronic
1119124159 14:72109874-72109896 TCAAAGTACTGTGTGGTATTGGG - Intronic
1119576301 14:75725791-75725813 TGAAAGGAGTATTTAGGACTGGG - Intronic
1123964393 15:25439807-25439829 TTAAAGTCATATTTGGTACCAGG + Intergenic
1126509893 15:49458289-49458311 TAAATGTACTATTTGGCACGTGG - Intronic
1127165485 15:56242201-56242223 GGAAAGTAATATTTGGAATTTGG - Intronic
1127602844 15:60555568-60555590 TTAAAATTCTGTTTGGTACTAGG + Intronic
1129359739 15:75017275-75017297 TGAAAATGCCATTTGGCACTAGG - Intronic
1129817532 15:78567925-78567947 TGAAAGTACTGTCTGGAAATAGG + Intronic
1130299428 15:82668551-82668573 AGAAAGAACTGTTTGGTATTTGG + Intronic
1135467044 16:22695674-22695696 TAAAAGTACTATGTGGGGCTGGG + Intergenic
1135483944 16:22847090-22847112 AGAAATAACTATTGGGTACTAGG - Intronic
1137922964 16:52510308-52510330 TCAAAGTAATATTTGGGACCAGG + Intronic
1140551172 16:75867541-75867563 AAAAATTACTATTGGGTACTAGG - Intergenic
1141247740 16:82325932-82325954 TTAAAGAAATATTTTGTACTGGG - Intergenic
1141490084 16:84367059-84367081 TCAAATTACTATTTCCTACTGGG + Intergenic
1143068789 17:4272214-4272236 AGAAAGCATTATTTGGTACAAGG + Exonic
1144313317 17:14034772-14034794 TGATAGAACAATTTGTTACTTGG - Intergenic
1148022854 17:44565098-44565120 TCAAAGTACTATCTGGTCCCGGG + Intergenic
1148169013 17:45503931-45503953 AGAAAAAACTATTGGGTACTAGG - Intergenic
1148279807 17:46339077-46339099 AGAAAAAACTATTGGGTACTAGG + Intronic
1148302025 17:46556933-46556955 AGAAAAAACTATTGGGTACTAGG + Exonic
1149021488 17:51970990-51971012 GGTAGGTACTATTTGGTAATTGG + Intronic
1149152304 17:53582412-53582434 AGAATATACTATTTGGTACTAGG - Intergenic
1150400205 17:64850397-64850419 AGAAAAAACTATTGGGTACTAGG - Intergenic
1153074270 18:1144726-1144748 TGAAAGTATTATTTGGGAACTGG + Intergenic
1153078249 18:1190944-1190966 TGAAAACACTATTTGTTATTGGG - Intergenic
1155492780 18:26416700-26416722 TGAATGTAGGATTTGTTACTAGG - Intergenic
1155825974 18:30443384-30443406 ATAAACTACTATTTGTTACTTGG + Intergenic
1155855121 18:30824405-30824427 TCAAAGTACTCTTTGGTAAATGG + Intergenic
1156483176 18:37448789-37448811 TGAAAGTTCCGTTTGGTACTGGG + Intronic
1156744182 18:40369360-40369382 GGTAAGTGCTATTCGGTACTGGG + Intergenic
1156887801 18:42155911-42155933 TGAAAGCACTATTAGGTATTAGG + Intergenic
1159024857 18:63174490-63174512 TGAATGTACCATTTTTTACTTGG - Intronic
1159171272 18:64770942-64770964 TAAAAATACTATTTTTTACTTGG + Intergenic
1159204939 18:65237128-65237150 TGAAATTACTCTTTGCTGCTGGG - Intergenic
1166957357 19:46473451-46473473 TGGAAGTACAATTTGGGCCTTGG + Intergenic
926057676 2:9784703-9784725 TAAAAGTACTAATGGATACTGGG + Intergenic
927286037 2:21357906-21357928 TGAAAGTATTCATTAGTACTTGG - Intergenic
930731031 2:54728153-54728175 TTAAAGTAATATTTGCTATTGGG + Intronic
930948651 2:57109364-57109386 TGAAATTACTTTTTGATACTTGG + Intergenic
931404781 2:61965400-61965422 TGAAGGTCCTATTTGGTATCTGG - Intronic
932839363 2:75067435-75067457 TGAACCTTCTATTTTGTACTAGG + Intronic
933081366 2:77991225-77991247 AAAAAGAACTATTGGGTACTAGG - Intergenic
933084702 2:78041063-78041085 TAAAAGTAATATATGGTAATTGG - Intergenic
934040181 2:88121876-88121898 TGAAACTATTACTTGTTACTTGG - Intergenic
934148905 2:89125911-89125933 GTAAATTAATATTTGGTACTAGG - Intergenic
934218392 2:90056135-90056157 GTAAATTAATATTTGGTACTAGG + Intergenic
935481104 2:103591511-103591533 TGAAAGTATTATTTGGGAACTGG - Intergenic
935554230 2:104490209-104490231 TGAAAGTACTATTAAGTCATGGG + Intergenic
935709600 2:105886177-105886199 TAAAACTTCCATTTGGTACTGGG - Intronic
936925892 2:117736586-117736608 TGAAAAGACTATTAGCTACTTGG - Intergenic
936947160 2:117941319-117941341 AGACAGTACTATTTGGTAAAAGG + Intronic
937069926 2:119055476-119055498 TGACAGTATTATTTGGTAACTGG + Intergenic
941278609 2:163522032-163522054 AAAAATAACTATTTGGTACTAGG - Intergenic
941776088 2:169395371-169395393 TGAAAGGCCTATTTGACACTGGG + Intergenic
942256079 2:174099498-174099520 TGAAGGAACTATTTGTTACTTGG + Intronic
942751609 2:179294039-179294061 TGAAAGATATTTTTGGTACTTGG - Intergenic
943141037 2:183981896-183981918 TTACAGTAGTATTTGATACTTGG - Intergenic
947828660 2:233123990-233124012 AGAAATAACTATTGGGTACTAGG + Intronic
947849310 2:233272419-233272441 TTAAAGTAATATTTGAAACTGGG + Intronic
1172074317 20:32282362-32282384 TGAAAGGACTTTTTGGTAAGGGG + Intronic
1173105129 20:40126574-40126596 AAAAAGAACTATTGGGTACTAGG - Intergenic
1173235591 20:41242787-41242809 TGGAAGTACTATCTAGTATTTGG - Intronic
1174205811 20:48837701-48837723 AAAAATAACTATTTGGTACTAGG + Intergenic
1182876870 22:33699697-33699719 TGAAAGAACTATTTTAGACTTGG - Intronic
1184395683 22:44236930-44236952 TTAAAGTACTGTTAGGTCCTCGG - Intergenic
949240624 3:1867288-1867310 TGAAACTAATATTTGGAACTAGG - Intergenic
949379204 3:3426312-3426334 AGAAATAACTATTGGGTACTGGG - Intergenic
949672147 3:6411387-6411409 TAAAAGTACTATCTGTTACATGG + Intergenic
950952963 3:17020636-17020658 AAAAAGTACTATTTTCTACTGGG - Intronic
951786852 3:26430478-26430500 TTCAAGTACTGTTAGGTACTGGG - Intergenic
952293836 3:32043529-32043551 TGAAAGTATTATTTGGGAACTGG + Intronic
952805807 3:37350431-37350453 TAAATGGACTTTTTGGTACTTGG + Intronic
953726534 3:45404127-45404149 TGAAACCACTATTTGTTATTTGG + Intronic
955674816 3:61436910-61436932 AAAAAATACTATTGGGTACTAGG - Intergenic
957148405 3:76453810-76453832 AGTAGTTACTATTTGGTACTTGG + Intronic
957189212 3:76984515-76984537 TGTAAGTACGATTTGGTTCCAGG + Intronic
959373297 3:105557031-105557053 TGAAAATACTATATGGAATTTGG - Intronic
959394862 3:105824459-105824481 TGACAGAAATATGTGGTACTTGG - Intronic
960203371 3:114865404-114865426 AGAAAGAAATATTTGGTCCTAGG + Intronic
961485504 3:127213070-127213092 TGAAAGTGCTATTTAATATTTGG - Intergenic
963620915 3:147605222-147605244 AGAAATTGCTATTTGGTTCTAGG - Intergenic
963831214 3:150011648-150011670 AGAAAAAACTATTGGGTACTAGG + Intronic
965026649 3:163310906-163310928 AGAAAGTACTGTTTGCTAGTAGG - Intergenic
965610710 3:170541026-170541048 TAAAAGTACTCTTTGCTAGTGGG + Intronic
971682933 4:29724684-29724706 TCAAAGCCCTTTTTGGTACTTGG - Intergenic
976658416 4:87513441-87513463 TCAAGGTAGTATTTAGTACTTGG - Intronic
977200587 4:94110443-94110465 AGAATGAACTATGTGGTACTAGG + Intergenic
977719775 4:100225416-100225438 TGGAAGTAATATGTGGGACTTGG - Intergenic
978852463 4:113355119-113355141 TGAAAGGACTAGTGAGTACTTGG - Exonic
980494594 4:133574986-133575008 TAAAAGTTCTATTTAGTACTGGG + Intergenic
981409549 4:144412821-144412843 TGAAAGAACTATTTTGTGATAGG - Intergenic
982761244 4:159286370-159286392 TACAAGTACTATTAGGTATTTGG - Intronic
983152187 4:164298185-164298207 TAAAAATACTATTTAGTAGTGGG - Intronic
983727772 4:170950917-170950939 GGAGAGAACTATGTGGTACTGGG + Intergenic
984056313 4:174933585-174933607 AGAAATAACTATTGGGTACTAGG - Intronic
984077332 4:175199450-175199472 TGAAAGGACTATTTGGTCTTTGG + Intergenic
984750578 4:183269182-183269204 TCTAAGTGCTATTTGGTAATGGG - Intronic
985920502 5:2967829-2967851 TGAAAGTTCTATTGTTTACTTGG - Intergenic
987357453 5:17077093-17077115 AGAAACTCCTATTTGGTATTTGG + Intronic
987639293 5:20591230-20591252 TTAAAGTGGTATTTGGGACTTGG + Intergenic
987901375 5:24016374-24016396 TGAAGTTACTATTTTGTATTTGG + Intronic
987978321 5:25044856-25044878 TGAAAGTATTATTTGGGAAGTGG + Intergenic
988326057 5:29769476-29769498 TGAGAGTCCTATGTGGTAGTTGG + Intergenic
988973958 5:36496847-36496869 TGAAAGCACAATTTGGTGGTGGG - Intergenic
989795798 5:45470756-45470778 AGAAAGTAATATTAGGCACTGGG + Intronic
990267571 5:54094257-54094279 TTGAAGTACTATTAGGTATTGGG - Intronic
990364726 5:55058725-55058747 TGAAAGTAACATTTGGGAATAGG + Intergenic
993433615 5:87863065-87863087 TTAAAGAACTATTTGAGACTGGG - Intergenic
994006509 5:94843986-94844008 TCACAGTCCTTTTTGGTACTTGG - Intronic
994990639 5:106992123-106992145 TGTAAGAACAATTTGGTGCTGGG - Intergenic
996548093 5:124702158-124702180 TGAATGTACTGTTTAGTACATGG - Intronic
997004254 5:129799958-129799980 TGAAAGTATTATTTGGGAACTGG + Intergenic
1000000377 5:157133004-157133026 TGCAAATACTACTTGATACTGGG - Intronic
1001141837 5:169151049-169151071 TAAAAATACAATTTGGGACTTGG + Intronic
1001464202 5:171947822-171947844 TGAAAGGACTACTTGGGCCTGGG + Intronic
1003652647 6:7975599-7975621 GGAAAGTATTTTTTGGTGCTGGG + Intronic
1004576858 6:16904735-16904757 TGAAAGCACTACTTACTACTTGG - Intergenic
1005655009 6:27927099-27927121 TGCAAATACTATGTGGTATTTGG - Intergenic
1006562092 6:34922374-34922396 TGACAGTACAATGTAGTACTTGG - Intronic
1007126188 6:39427522-39427544 TTAAAGGACTATTTGGTATAGGG - Intronic
1009283214 6:61777960-61777982 AAAAATTACTATTGGGTACTAGG - Intronic
1010497266 6:76550039-76550061 AGAAAAAACTATTGGGTACTAGG - Intergenic
1011737240 6:90323607-90323629 TGAAATTACTCTTTGGTTCATGG + Intergenic
1012499766 6:99875556-99875578 TAAAAGCACCATTTGGTGCTTGG - Intergenic
1012703494 6:102493628-102493650 GGGTAGCACTATTTGGTACTGGG - Intergenic
1013144928 6:107379820-107379842 TGAAAATACTTTTTGTTAATAGG + Intronic
1014340081 6:120193531-120193553 AAAAATAACTATTTGGTACTAGG + Intergenic
1014540672 6:122671938-122671960 TTAAGGTAATTTTTGGTACTAGG - Intronic
1016379822 6:143464687-143464709 TGAAATTACTATTTGTAATTTGG + Intronic
1017605935 6:156133076-156133098 AAAAATTACTATTGGGTACTAGG + Intergenic
1019477089 7:1249359-1249381 GGAAAGTACAATCTGGGACTGGG - Intergenic
1021043059 7:15887683-15887705 TGAAAGTACCATGTGGTAAATGG - Intergenic
1021390296 7:20084763-20084785 ATTAAGCACTATTTGGTACTAGG + Intergenic
1021721494 7:23508961-23508983 TGAGAGTATTATTTGTTTCTGGG + Intronic
1022963605 7:35453488-35453510 TGAGAGTAGTATTTGGTATAGGG + Intergenic
1024245772 7:47469193-47469215 TGAAATTATTTTTGGGTACTTGG - Intronic
1026974903 7:74491435-74491457 AGAAATAACTATTGGGTACTGGG - Intronic
1027409133 7:77895125-77895147 AGAAATATCTATTTGGTACTTGG + Intronic
1027908224 7:84213830-84213852 TGAAAGTACTATTTGGTACTAGG - Intronic
1027957136 7:84895077-84895099 AAAAATAACTATTTGGTACTTGG - Intergenic
1028191432 7:87857605-87857627 TGAAAGTATTATTTGGGAACTGG - Intronic
1030043574 7:105474409-105474431 GTATAGTACTAGTTGGTACTAGG + Intronic
1030454263 7:109753102-109753124 TGAAAATAATATTTGGTATTTGG + Intergenic
1031389055 7:121190575-121190597 TGAAAATAATATTTGGGATTAGG - Intronic
1031608979 7:123802733-123802755 TGAAAGTATTAGTTAATACTTGG - Intergenic
1032906302 7:136371359-136371381 AGAAATAACTAATTGGTACTGGG - Intergenic
1034233304 7:149549277-149549299 TGAAATTCTTATTTGGGACTCGG + Intergenic
1037746946 8:21653146-21653168 TGACAGTACTATTTAGGACAGGG - Intergenic
1038130681 8:24727761-24727783 TGAAAGGAGTCTTTGATACTTGG + Intergenic
1039514335 8:38119397-38119419 TTTAAGTATTATTTGGTGCTGGG + Intronic
1039908026 8:41800230-41800252 TTAAAGTAGTATCTGGTACCAGG - Intronic
1040116346 8:43624714-43624736 TGAAACTACTTTGTGGTTCTTGG + Intergenic
1042200066 8:66272967-66272989 AAAAAGTAATATTGGGTACTAGG + Intergenic
1042908249 8:73796841-73796863 TGAAAGTATTATTGGATACCAGG + Intronic
1043375938 8:79649597-79649619 TAAAAGCATTTTTTGGTACTAGG + Intronic
1043693402 8:83186535-83186557 AAAAAGAACTATTGGGTACTGGG + Intergenic
1046457991 8:114493638-114493660 TGCAAGTTTCATTTGGTACTAGG - Intergenic
1048806832 8:138248991-138249013 TGAAAGAACAATTTGATCCTAGG + Intronic
1049910604 9:263340-263362 TAAAAGTACTAATTAATACTAGG - Intronic
1050465840 9:5922488-5922510 TGAAAGCTGTATTTGGTAGTTGG + Exonic
1052287128 9:26799066-26799088 AGAAATAACTATTGGGTACTAGG - Intergenic
1052446527 9:28568358-28568380 AAAAACAACTATTTGGTACTAGG + Intronic
1052510690 9:29416018-29416040 TAAAAGTACTATATTATACTTGG - Intergenic
1054884980 9:70186556-70186578 TGAAAGTACTATTTTCCTCTGGG + Intronic
1055250232 9:74294541-74294563 TGTAAGTACTGTCTGGTACCTGG - Intergenic
1057140154 9:92721808-92721830 TGTAAGTACCATTTGGTCATTGG - Intronic
1058081096 9:100701857-100701879 GGAAAGTACTTTTTGCTAGTGGG + Intergenic
1058828550 9:108795791-108795813 CTAAAGTACTATTTGGTTCCAGG - Intergenic
1059618648 9:115978826-115978848 TGTAAGTAACATTTGGGACTTGG - Intergenic
1188018680 X:25133756-25133778 AAAAATTACTATTGGGTACTGGG - Intergenic
1188373870 X:29403521-29403543 TGAGAGTACTCATTGCTACTGGG + Intronic
1189006891 X:37005496-37005518 TGGATGTACTTTTTGCTACTTGG + Intergenic
1190810407 X:53877943-53877965 TGAAAGTATGTGTTGGTACTGGG + Intergenic
1191224146 X:58023277-58023299 AAAAATAACTATTTGGTACTAGG + Intergenic
1193152862 X:78142706-78142728 AAAAATAACTATTTGGTACTAGG - Intergenic
1193623158 X:83782468-83782490 TGAAAGTATTATTTGGGAACTGG - Intergenic
1193894297 X:87093171-87093193 AAAAAATACTATTGGGTACTAGG - Intergenic
1196475751 X:116083316-116083338 AGAAACAACTATTGGGTACTAGG + Intergenic
1198332576 X:135635253-135635275 TGCAACGACTATTAGGTACTTGG - Intergenic
1199306540 X:146273488-146273510 AAAAAATACTATTGGGTACTAGG - Intergenic
1199831500 X:151552992-151553014 GGCAAGTACTATTTATTACTGGG + Intergenic
1199879655 X:151963420-151963442 TGATAGTACTTGTTAGTACTTGG + Intronic