ID: 1027908229

View in Genome Browser
Species Human (GRCh38)
Location 7:84213866-84213888
Sequence AGGTTGCCCCAGCACTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027908225_1027908229 6 Left 1027908225 7:84213837-84213859 CCAAATAGTACTTTCATTTCTAA 0: 1
1: 0
2: 5
3: 33
4: 403
Right 1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG 0: 1
1: 0
2: 0
3: 9
4: 77
1027908224_1027908229 13 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027908229 Original CRISPR AGGTTGCCCCAGCACTATCA TGG Intronic