ID: 1027908229

View in Genome Browser
Species Human (GRCh38)
Location 7:84213866-84213888
Sequence AGGTTGCCCCAGCACTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027908225_1027908229 6 Left 1027908225 7:84213837-84213859 CCAAATAGTACTTTCATTTCTAA 0: 1
1: 0
2: 5
3: 33
4: 403
Right 1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG 0: 1
1: 0
2: 0
3: 9
4: 77
1027908224_1027908229 13 Left 1027908224 7:84213830-84213852 CCTAGTACCAAATAGTACTTTCA 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027908229 Original CRISPR AGGTTGCCCCAGCACTATCA TGG Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
903443870 1:23408322-23408344 CTGTTGCCCCATCACTGTCAGGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906603871 1:47151418-47151440 AGGATGCCCCTGCCCCATCAGGG - Intergenic
907581738 1:55578333-55578355 AGCTTTCCCCAGCACTTCCAAGG - Intergenic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
915996932 1:160572960-160572982 AGGGTGCCCCAGCCCAATCCAGG - Intronic
916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG + Intergenic
922486939 1:225980754-225980776 AGGTTGCCAGAGCACTAGCTGGG - Intergenic
922890364 1:229057492-229057514 AGGCTGGACCAGCACTCTCAGGG - Intergenic
923183128 1:231542552-231542574 AGGTAGCCCAAGAGCTATCAGGG + Exonic
923409110 1:233689968-233689990 AGGTTTGCCCAGAACTATCCTGG - Intergenic
924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG + Intronic
1074424609 10:113339855-113339877 AGGTTTCCCCAGGACTGTAATGG - Intergenic
1079973478 11:27064225-27064247 AGGATGTCCCAACAGTATCAGGG + Intronic
1083328054 11:61883674-61883696 AGGTGGCCCCAGAACTGACATGG - Intronic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1091875724 12:3931480-3931502 AGGTGGAGCCCGCACTATCATGG - Intergenic
1094282833 12:28759493-28759515 GAGTTGCCCCAGCATTCTCATGG + Intergenic
1100194897 12:92234316-92234338 AGTTTGCCCTAGCACCATCTGGG - Intergenic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1101592754 12:106138748-106138770 AGGTCGCCCCCGCAGCATCAGGG + Exonic
1101735063 12:107457181-107457203 AGGTTTGCCCAGGATTATCAAGG - Intronic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1116864696 14:50022206-50022228 AGCTGGCCCCAGATCTATCAAGG - Intergenic
1118232871 14:63970237-63970259 AGAGTGCACCAGCACAATCATGG + Intronic
1121224064 14:92308420-92308442 ACGTGTCCCCAGCAGTATCACGG + Intergenic
1122042821 14:99001357-99001379 AGTTTCCCCGAGCACCATCAGGG - Intergenic
1122137749 14:99644721-99644743 GTGTTGCCCCAGGACTCTCAGGG - Intergenic
1125270154 15:37929826-37929848 AGGTTGCCCAACCAGTATCTTGG - Intronic
1151756754 17:76079623-76079645 AGGAGACCCCAGCACTATCCAGG - Intronic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1155229381 18:23757864-23757886 AGGCTGCGCCAGCTCCATCATGG - Intronic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1162689096 19:12414033-12414055 AGGCTGCCACAGAACTTTCAGGG + Intronic
926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG + Intronic
934156599 2:89207030-89207052 AGGTTGCACCAGGAGTAGCAAGG - Intergenic
934210716 2:89975721-89975743 AGGTTGCACCAGGAGTAGCAAGG + Intergenic
943067307 2:183102101-183102123 AGGTTGCCCATTCACTCTCATGG + Intergenic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
945278965 2:208017431-208017453 AGGTTCCTCCAGCATTTTCAAGG + Intronic
1178484253 21:33007341-33007363 AGGTTGCCCAGGCAATTTCAGGG + Intergenic
1183252963 22:36743373-36743395 AGGTTGCCCCAAAAGTAGCATGG - Intergenic
949567043 3:5254489-5254511 AGCTTGCCCCAACACCATCTTGG - Intergenic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954653982 3:52182685-52182707 AGGTTGCCCCACCAACATCTGGG + Intergenic
954973299 3:54670048-54670070 AGGTTTCCCCAGCTATATGATGG - Intronic
956816892 3:72915883-72915905 AGGCTGGCCCAGCAGTGTCAGGG + Intronic
957305441 3:78452274-78452296 AAGTTGCCACAGCATTCTCAGGG + Intergenic
958991858 3:100855304-100855326 ATGTTTCCACAGCAGTATCAGGG - Intronic
959682459 3:109111344-109111366 AGGTTGCCTCAGCACTACAGTGG + Intronic
960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG + Intronic
972357635 4:38295709-38295731 AGGTTGCCTGATCACTCTCATGG - Intergenic
973242790 4:47975276-47975298 ATGTTGCCCCAGCACACACAGGG + Intronic
973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG + Intronic
980159808 4:129146831-129146853 ATGATCCCCCAGCACCATCAGGG + Intergenic
994345565 5:98681567-98681589 TGGTTGCCCAAGGACTATCTGGG + Intergenic
994586082 5:101711194-101711216 AGGTTGCCCGATCACTCTGATGG + Intergenic
996958917 5:129220116-129220138 ACATTGCGCCAGCACTATAAGGG - Intergenic
999376122 5:151087435-151087457 AGGTTGCCCCAGCCCATTCTCGG - Intronic
1003313258 6:4987442-4987464 AGGTTGCCCCAGCTAGAGCAGGG + Intergenic
1011703096 6:89973395-89973417 AGGTTGCTCCACAATTATCATGG - Intronic
1013468216 6:110436252-110436274 TGGTGCCACCAGCACTATCAGGG - Intronic
1016784258 6:147992609-147992631 AGTTTGCCCCAGCAACTTCATGG - Intergenic
1016892761 6:149022772-149022794 AGGTGGCCCTACCACCATCAGGG + Intronic
1018170146 6:161138072-161138094 AGCTTGCCCCCGCCCTACCAGGG + Intronic
1025107684 7:56185804-56185826 ATGTTTCCCCAGCACCATCTTGG - Intergenic
1026310564 7:69180284-69180306 ATGTTTCCCCAGCACCATCTTGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028373399 7:90119513-90119535 AAATTGACCCAGCTCTATCAGGG + Intergenic
1029489064 7:100860545-100860567 GGGGTGCCCCAGCACTTTGAGGG + Intronic
1030856951 7:114570528-114570550 AGGTTCCTACAGCAGTATCATGG + Intronic
1035604486 8:920698-920720 AGATTGCCCAAGCACGATCATGG - Intergenic
1050348679 9:4718944-4718966 AGGTTGCCCCAGGAGCAGCAGGG - Intronic
1056543738 9:87595855-87595877 AGGTTGCCACGGCACCAACAGGG - Intronic
1061589298 9:131588499-131588521 GGGTTGTCCCAGCACGAACATGG - Intronic
1186472777 X:9834265-9834287 AGGCTTCCCCAGCACTCTCCTGG - Intronic
1189744553 X:44156882-44156904 ATGTTGCCCTGGCACTGTCATGG - Intronic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1190897825 X:54638920-54638942 AGTTTGCCCCAGCATTACCCTGG + Intergenic
1193875299 X:86855285-86855307 AGGTTGCCTCTTCACTCTCATGG + Intergenic
1195919823 X:109972467-109972489 ATGTTGCCAAAGCAGTATCAAGG - Intergenic
1198427596 X:136535601-136535623 AGGTTGGCCCAGAACTACCATGG - Intronic
1199967827 X:152834445-152834467 GGGTTGCCCCAGCATAATCAAGG + Intronic
1200496281 Y:3887219-3887241 AGGTTGTCCCATCACAAGCATGG - Intergenic