ID: 1027908871

View in Genome Browser
Species Human (GRCh38)
Location 7:84221724-84221746
Sequence TCTTACATAGGCATAGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027908869_1027908871 17 Left 1027908869 7:84221684-84221706 CCGTGAGAACACACATAGCATTT 0: 1
1: 0
2: 3
3: 36
4: 243
Right 1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG No data
1027908868_1027908871 30 Left 1027908868 7:84221671-84221693 CCAGTGAGTAGAGCCGTGAGAAC 0: 1
1: 0
2: 5
3: 28
4: 209
Right 1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027908871 Original CRISPR TCTTACATAGGCATAGTTTA TGG Intronic
No off target data available for this crispr