ID: 1027909756

View in Genome Browser
Species Human (GRCh38)
Location 7:84234975-84234997
Sequence TTTACTCTGCATGTGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027909752_1027909756 -2 Left 1027909752 7:84234954-84234976 CCCATGCTGTTTTCCTGCGTTTT 0: 1
1: 0
2: 3
3: 19
4: 381
Right 1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG 0: 1
1: 0
2: 0
3: 17
4: 176
1027909753_1027909756 -3 Left 1027909753 7:84234955-84234977 CCATGCTGTTTTCCTGCGTTTTT 0: 1
1: 0
2: 0
3: 46
4: 491
Right 1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG 0: 1
1: 0
2: 0
3: 17
4: 176
1027909751_1027909756 -1 Left 1027909751 7:84234953-84234975 CCCCATGCTGTTTTCCTGCGTTT 0: 1
1: 0
2: 3
3: 22
4: 418
Right 1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG 0: 1
1: 0
2: 0
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027909756 Original CRISPR TTTACTCTGCATGTGGCATA AGG Intronic
900837201 1:5014099-5014121 TTGACTCTGCAAATGGCAGAAGG - Intergenic
902316241 1:15621253-15621275 TTACCTCTGTAGGTGGCATATGG + Intronic
905112229 1:35604171-35604193 TTTACTGTTCCTGTGGCTTAAGG - Intronic
906549964 1:46656458-46656480 ACTACTCTCAATGTGGCATAAGG + Intronic
907048996 1:51317129-51317151 TTCTCTCTGCATGGGGCATCTGG - Intronic
907511394 1:54963660-54963682 TTTACTCTGCATCTGCCCTATGG - Intergenic
908414200 1:63896832-63896854 TTTATTCTGCATCTGAAATAAGG - Intronic
908826301 1:68135847-68135869 TTTACTGTACATGTGGAAAATGG - Intronic
909204967 1:72744199-72744221 TTTACTCAGGATGTGGCATTTGG - Intergenic
909588334 1:77316863-77316885 TTGACTCTCCACTTGGCATAAGG - Intronic
910727532 1:90354745-90354767 TTTACTCTGCATCTAGCACAAGG - Intergenic
911178526 1:94841453-94841475 GTTACTGTGGATATGGCATAAGG + Intronic
911704630 1:100997255-100997277 CTAACTCTACATGGGGCATAGGG + Intronic
917215306 1:172671893-172671915 TTTATTCTGTGTGTGTCATAAGG - Intergenic
917976580 1:180243725-180243747 TCTAGTGTGCATGTGTCATATGG - Intronic
918603824 1:186396958-186396980 TGAACTCTACATGTGTCATATGG + Intronic
920738503 1:208557898-208557920 TCTACTCTGGTTGTGGCCTAGGG - Intergenic
920768284 1:208854479-208854501 TTTACTCGGCATATGCCCTATGG - Intergenic
920783769 1:209020641-209020663 TGTACTCTGCATGTGAGATATGG + Intergenic
920786998 1:209051275-209051297 ATCACTCTGCTTGTGGCCTAAGG - Intergenic
921787698 1:219251443-219251465 TTGATTTTGCATGTGGCATAAGG + Intergenic
922996570 1:229967478-229967500 TTTTCTCTGCATGTTTCATTGGG - Intergenic
924032643 1:239901965-239901987 TTCACTCTGGATGTGGCAAGGGG + Intronic
1063357384 10:5413138-5413160 TTTTCCCTGCCTGTGGCAAAGGG + Intronic
1065815512 10:29479414-29479436 TTTACTCTGCCTGTAGCTGAGGG - Intronic
1067492283 10:46721534-46721556 TTTACTCTCCATGTGGCCTTAGG - Intergenic
1067602380 10:47618850-47618872 TTTACTCTCCATGTGGCCTTAGG + Intergenic
1068251038 10:54440894-54440916 TTTATTCTCCATGTGGCCTTAGG + Intronic
1069095884 10:64259086-64259108 TTTAATCCACATGTTGCATATGG - Intergenic
1070654287 10:78260693-78260715 CTTACTCTACATGTGTAATATGG + Intergenic
1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG + Intergenic
1071653734 10:87424260-87424282 TTTACTCTCCATGTGGCCTTAGG + Intergenic
1073922742 10:108478381-108478403 CTTACTCCTCATGTGGCACAAGG - Intergenic
1074381137 10:112981689-112981711 TCTGCTTTGCATGTGGCATGTGG - Intronic
1078701737 11:13691533-13691555 TTGCCTGTGCCTGTGGCATAGGG - Intronic
1079040616 11:17056080-17056102 TGTACACTGCATGTGACATTAGG + Intergenic
1079089173 11:17468845-17468867 TTTACTGAGCATGTGCCATGGGG - Intronic
1081188860 11:40079205-40079227 TTTATTTTGCATTTGGCATGTGG - Intergenic
1086578767 11:88372140-88372162 CTTACTATACGTGTGGCATATGG - Intergenic
1086914555 11:92513944-92513966 TAGACTTGGCATGTGGCATATGG + Intronic
1087591314 11:100191940-100191962 TTCACTGTGCATGTATCATATGG + Intronic
1087676995 11:101175096-101175118 TTTTCTGTGAATCTGGCATAGGG + Intergenic
1087994815 11:104792322-104792344 ATTGCTCTGCATTTGGCATAGGG + Intergenic
1091215631 11:133899664-133899686 TTTACTCTGCTGGTTGCATGTGG + Intergenic
1092102543 12:5897718-5897740 TTTGGTCTGTATGTGGCATGAGG - Intronic
1099016176 12:77346887-77346909 TTTACACTGCATATTGCTTAAGG - Intergenic
1103178141 12:118882736-118882758 ATTCTTTTGCATGTGGCATATGG + Intergenic
1103290560 12:119842549-119842571 TGTATTCTGCATGTGGCTGATGG - Intronic
1104309674 12:127643128-127643150 TTTACTCAGCCTATGGCCTATGG - Intergenic
1108862919 13:54884279-54884301 TCTACACAACATGTGGCATAGGG - Intergenic
1109020608 13:57086257-57086279 TTGTCTCTGCATATAGCATACGG - Intergenic
1109335092 13:60983960-60983982 TTTACACTGCTTTTGGCATGTGG - Intergenic
1110420871 13:75306693-75306715 TTTACTCTGTATCTTACATATGG + Intronic
1111007371 13:82265216-82265238 TGTTATTTGCATGTGGCATACGG - Intergenic
1111479999 13:88811541-88811563 TGTACACTGGATGTGGGATATGG + Intergenic
1113061105 13:106323387-106323409 TTTACCCTGGATGTGGGACATGG + Intergenic
1115445963 14:33490298-33490320 TTTTCTCTCCAAGTGTCATAAGG - Intronic
1117072008 14:52066231-52066253 GTTACTCTCTATGTTGCATAAGG - Intronic
1117390260 14:55255970-55255992 TTTATTTTGCATGAAGCATATGG + Intergenic
1117608596 14:57459069-57459091 TTTATGTTGCATCTGGCATATGG + Intergenic
1120671607 14:87368598-87368620 TTTCCTCTTCATGTGGCCCAGGG + Intergenic
1124615889 15:31241817-31241839 AATACTCTGCATGTGGCAACTGG - Intergenic
1126152402 15:45535358-45535380 TTTAATTACCATGTGGCATAGGG - Intergenic
1127364816 15:58278787-58278809 TTCACCCTTCATGTGGTATATGG + Intronic
1131656142 15:94461157-94461179 TTTACTCAACATGTAGCATTTGG + Intronic
1133385574 16:5367473-5367495 TTCTCACTGCATGTGCCATATGG + Intergenic
1134427487 16:14164906-14164928 TTGACTCTGCATGTAGAAGAAGG + Intronic
1137240311 16:46650338-46650360 TTAACTTTCCATTTGGCATAGGG - Intergenic
1137306697 16:47207640-47207662 TTAACTCTGCATCTGTTATACGG - Intronic
1137742530 16:50794443-50794465 TTTCTTCTGCATGTGGCACAGGG + Intronic
1143222072 17:5270849-5270871 TTTCCTGTGTACGTGGCATATGG + Intergenic
1147567108 17:41544543-41544565 TGAATTCTGCATGTGGCATAGGG - Intergenic
1149508999 17:57221823-57221845 TTTTCTCTGCATGTTTCATTTGG - Intergenic
1151031570 17:70746500-70746522 TTTATTCTTCATGGGTCATAGGG - Intergenic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1155809369 18:30212198-30212220 TTTACTCTGTATCTGGCACTGGG - Intergenic
1155950645 18:31908777-31908799 TTTTCTCTATATGTGGCAAAAGG + Exonic
1157242845 18:46027377-46027399 TTTAAAAGGCATGTGGCATATGG - Intronic
1157755817 18:50216724-50216746 TTTACTCTGTATGCCCCATAGGG + Intergenic
1157912908 18:51636135-51636157 TTTTCTCTTCATGGGACATAAGG + Intergenic
1157988711 18:52469850-52469872 TTTACTCTTCATCTGGCAGCTGG - Intronic
1158042047 18:53106266-53106288 TCCACTCTGCATTTGGCAGATGG - Intronic
1159704608 18:71671943-71671965 TTTTATCAGCATGTGGCATTTGG - Intergenic
1159771910 18:72556090-72556112 TGTCCTGTGCATGTAGCATAAGG + Intronic
1160056005 18:75481479-75481501 TTTAGTTTGTATATGGCATAAGG + Intergenic
1160396320 18:78574817-78574839 TGTGCCCTGGATGTGGCATATGG + Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166673211 19:44723880-44723902 TTCACCCTGCATGTGGCAGCTGG - Intergenic
1167034116 19:46983387-46983409 CTTACTCTGTATGAGGCACACGG - Intronic
1167195369 19:48024478-48024500 CTTACAATGCATGTGGCTTATGG + Intronic
926644169 2:15270870-15270892 TTCACTCTGAATCTGACATATGG + Intronic
927431341 2:23028670-23028692 TTTCCTCAGCATTTAGCATAGGG - Intergenic
927644264 2:24866225-24866247 TTTACTTTTCTTGTGGCAGATGG - Intronic
929975379 2:46628868-46628890 TCAACTCTGGCTGTGGCATAAGG - Intergenic
932308593 2:70721791-70721813 TATAATCTGCATGTGGGATTGGG - Intronic
934971659 2:98769221-98769243 TATTCTCTGCAAGTGGCAGAAGG - Intergenic
935469332 2:103438060-103438082 TTTTCTCTGAATGTGGCTTGAGG + Intergenic
937402538 2:121597114-121597136 TTAACTCTGGTTGTTGCATAAGG + Intronic
937871940 2:126792336-126792358 TTTCCCCTGCATGGGGCATCAGG - Intergenic
938301633 2:130218402-130218424 TTTACTCTGAAAATGGCAAATGG + Intergenic
938455071 2:131456051-131456073 TTTACTCTGAAAATGGCAAATGG - Intergenic
939259851 2:139793131-139793153 TCTTCTCAGAATGTGGCATATGG - Intergenic
943251512 2:185526454-185526476 TTTATTCTGGATATGGAATATGG + Intergenic
943962446 2:194283074-194283096 TTTACTTTGCAGGTTGCAAAAGG - Intergenic
946136485 2:217651775-217651797 TCTCCTCTGCATGTGGCAAAAGG - Intronic
947647475 2:231754244-231754266 TTTACTCTGCAGTTGGTACATGG - Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1170895111 20:20405835-20405857 TTTGCTCTGCATCTTGCATCAGG + Intronic
1172803213 20:37592751-37592773 TGTACTCTCCATGAGGCATTTGG - Intergenic
1173768481 20:45636096-45636118 TTTACTCTCCATGTGGCCACTGG - Intergenic
1173791659 20:45831983-45832005 ATTACTCTTCATTTGGCTTATGG - Intronic
1174252472 20:49230097-49230119 TTTTCTCTGCATCTGGCCTGAGG + Intronic
1174530718 20:51211420-51211442 AATACTCTGCATGTGGCAACAGG - Intergenic
1175009563 20:55721539-55721561 TTTACTCGGCATATGCCCTACGG - Intergenic
1175622333 20:60458743-60458765 TTCGCTCTGTATGTGGCATGTGG - Intergenic
1178087436 21:29126114-29126136 AGGACTCTGCATGTGCCATACGG + Intronic
1180396324 22:12346435-12346457 TTTCCTCTGTAGGTGGCAAAGGG + Intergenic
1180396396 22:12347971-12347993 TTTCCTCCGTAGGTGGCATAGGG + Intergenic
1180403317 22:12516117-12516139 TTTCCTCCGTAGGTGGCATAGGG - Intergenic
1180403388 22:12517656-12517678 TTTCCTCTGTAGGTGGCAAAGGG - Intergenic
949119189 3:365179-365201 TATACTCTTAATGTGGCATTTGG - Intronic
951375340 3:21908016-21908038 TTTCCTCTTCATGTTGAATATGG - Intronic
952486185 3:33813032-33813054 TTTAATTTTCATGTAGCATATGG + Intronic
953202429 3:40789405-40789427 TTTACTCTGCATGGTCCATGTGG - Intergenic
953466386 3:43124126-43124148 TTTTCTCTTCATGTGTCATCTGG - Intergenic
955341878 3:58131224-58131246 GTTGCTCTGGATGTGGCAGATGG + Intronic
962169854 3:133089487-133089509 TTTACTCTGAATGTGCCTCATGG + Intronic
962480178 3:135791227-135791249 TTGACCCTGCATGTGGAATGTGG + Intergenic
966154836 3:176904334-176904356 TGTACTCTGCATGGGACACAGGG + Intergenic
971446950 4:26760602-26760624 TTTATTCTGGATGTAGCATATGG + Intergenic
972339283 4:38137123-38137145 TTTATTCTCCAGGTGGCAAATGG + Exonic
974865605 4:67577320-67577342 TTCACTCTGCATGGATCATAGGG - Intronic
980008435 4:127567538-127567560 TTTTCCATGTATGTGGCATATGG - Intergenic
980457267 4:133061016-133061038 TTTACACTGCATTTTGCTTAAGG - Intergenic
980495871 4:133587137-133587159 GTTGCTCTGCAAGTGGCAGAGGG + Intergenic
981389071 4:144166626-144166648 TTTACTCTGCTTATGGCCAAAGG + Intergenic
982341737 4:154307326-154307348 TTTAGTGGGCATGTGTCATAAGG - Intronic
982608148 4:157539413-157539435 TTTAGGCTGCATGTAGCACAGGG + Intergenic
983094102 4:163541834-163541856 TTTAATCTTCCTGTGGCATTGGG - Intronic
983660300 4:170125001-170125023 TTTACACTGTTTGTGGCATTTGG + Intergenic
984493143 4:180461377-180461399 TTTAATCTGCCTTTTGCATATGG - Intergenic
987937156 5:24480945-24480967 TTAACTTTGCTTTTGGCATAGGG + Intergenic
989387874 5:40871404-40871426 TTTACTTTCCCTTTGGCATAAGG + Intergenic
990049119 5:51473930-51473952 TCTACTCTGCCAGTGGCAGAGGG + Intergenic
990524319 5:56609924-56609946 TGTACTCCGAATGTGGCAAATGG - Intergenic
992112018 5:73503958-73503980 ACTACTCTGTGTGTGGCATAAGG - Intronic
993162523 5:84311091-84311113 TTTACTCTTCTTGTGGCTGATGG + Intronic
994362133 5:98864205-98864227 TTTATTCTGATTTTGGCATAAGG - Intronic
995447779 5:112265622-112265644 TTTAGTCTGCAAGTGCCACAAGG + Intronic
995892304 5:116968086-116968108 TGTACTTTGCAGGAGGCATAAGG + Intergenic
998562302 5:143183045-143183067 TTTCATTTGCATGAGGCATAAGG - Intronic
1001463738 5:171943214-171943236 TGTTCTCTGCATGTAACATAAGG + Intronic
1003864783 6:10353036-10353058 TTTCCTCTGCAAGTCCCATAAGG - Intergenic
1004265560 6:14145697-14145719 TTTACTCAGCATCTGGCACTGGG - Intergenic
1006023440 6:31131830-31131852 TCTACTGCGCATGTGCCATAGGG - Intronic
1010293308 6:74165666-74165688 TCCACTCTGCATATGGCAAAAGG - Intergenic
1010354758 6:74919312-74919334 TTTCCTCTGCATGTTTTATATGG + Intergenic
1011053620 6:83181872-83181894 TTGACTGTGCAAATGGCATAGGG - Exonic
1011905596 6:92363341-92363363 TTTACTTTACAAGTGCCATATGG - Intergenic
1016265141 6:142223923-142223945 GTTACTATGCATATGGCCTATGG + Exonic
1022232710 7:28429405-28429427 TTTTCTCAGCATCTGGCACATGG + Intronic
1024614075 7:51093295-51093317 TTTACTTTGCATTTCTCATATGG - Intronic
1025278686 7:57608794-57608816 TATCCTTTGCATCTGGCATACGG - Intergenic
1027909756 7:84234975-84234997 TTTACTCTGCATGTGGCATAAGG + Intronic
1030313025 7:108086893-108086915 TTTACTGTGCATGTTACCTAGGG - Intronic
1033891676 7:146019945-146019967 TCAACTCTTCATGTGCCATAAGG - Intergenic
1038242268 8:25820811-25820833 TTATCTCTGCTTGTGGGATAGGG - Intergenic
1038849765 8:31264464-31264486 TTTCCTTTGCATGTAGCATGTGG + Intergenic
1038978533 8:32729243-32729265 TTTAGTCTACATATGGTATATGG + Intronic
1043675604 8:82949070-82949092 GTTACTCAGCATGGGGCATGGGG - Intergenic
1045748933 8:105458862-105458884 TTTACTCTGTAAGTTGAATAAGG + Intronic
1046486610 8:114895828-114895850 TTTACTCAGCATATGCCCTATGG - Intergenic
1046744760 8:117864839-117864861 TCTGGTCTGCATGTGGCACAAGG + Intronic
1047454214 8:124994384-124994406 TATACTCAGTATTTGGCATATGG - Intergenic
1047712261 8:127564342-127564364 TTTACTTTACATTTTGCATATGG - Intergenic
1048130678 8:131693796-131693818 TTCACCCTGGATGTGGAATATGG - Intergenic
1048237270 8:132703350-132703372 TTTACCCTGCATGGGACAGATGG + Intronic
1048756946 8:137750043-137750065 TGTAATCTACATGAGGCATAGGG - Intergenic
1049096513 8:140551431-140551453 TTTATTCTGCAAATGGCAAAAGG + Exonic
1052402443 9:28017607-28017629 TTTACTCTGTTTGTGGCTTAAGG - Intronic
1058077083 9:100662030-100662052 TTTTCTTTGAATGTGGCATAAGG + Intergenic
1061702103 9:132423772-132423794 TTTACCCTTCATGTGGCCTTGGG - Intronic
1203415121 Un_KI270584v1:2922-2944 TTTCCTCCGTAGGTGGCATAGGG + Intergenic
1186921868 X:14291290-14291312 TTTAGTCTTTATGGGGCATATGG - Intergenic
1187635744 X:21226159-21226181 TTTTCTCTCCAAGTGACATATGG - Intergenic
1187801181 X:23064812-23064834 TTTTCTCTGCATGGTGCATATGG - Intergenic
1188341452 X:29006994-29007016 TTGACTCTGCATGTAGCAATTGG + Intronic
1191934631 X:66413264-66413286 TCTACTTTGCTTGTGCCATATGG + Intergenic
1192180236 X:68911828-68911850 TTTGCCCTTCATGTGGCAAATGG + Intergenic
1193812969 X:86073546-86073568 TTCTCTCTGCATGTCACATAAGG + Intergenic
1195936083 X:110126989-110127011 TGTACAGTGCATGTGGCATAAGG - Intronic
1198721767 X:139629601-139629623 TTTACACTGACTGTTGCATAAGG - Intronic
1202044535 Y:20725325-20725347 TTTACTCGGCATACGGCCTATGG + Intergenic