ID: 1027920411

View in Genome Browser
Species Human (GRCh38)
Location 7:84386375-84386397
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027920407_1027920411 13 Left 1027920407 7:84386339-84386361 CCATGCTGTTTCGATGTTTTGGA 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1027920411 7:84386375-84386397 GCCTCCTAGTAACCACAGCAGGG No data
1027920405_1027920411 20 Left 1027920405 7:84386332-84386354 CCATAATCCATGCTGTTTCGATG 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1027920411 7:84386375-84386397 GCCTCCTAGTAACCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr