ID: 1027926606

View in Genome Browser
Species Human (GRCh38)
Location 7:84473084-84473106
Sequence CTCTGAAGCAATTTTATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027926606_1027926608 -9 Left 1027926606 7:84473084-84473106 CCATACATAAAATTGCTTCAGAG No data
Right 1027926608 7:84473098-84473120 GCTTCAGAGAAGTATTGTTTGGG No data
1027926606_1027926611 13 Left 1027926606 7:84473084-84473106 CCATACATAAAATTGCTTCAGAG No data
Right 1027926611 7:84473120-84473142 GCTTAATGGGAAAAAAGAAATGG No data
1027926606_1027926607 -10 Left 1027926606 7:84473084-84473106 CCATACATAAAATTGCTTCAGAG No data
Right 1027926607 7:84473097-84473119 TGCTTCAGAGAAGTATTGTTTGG No data
1027926606_1027926610 0 Left 1027926606 7:84473084-84473106 CCATACATAAAATTGCTTCAGAG No data
Right 1027926610 7:84473107-84473129 AAGTATTGTTTGGGCTTAATGGG 0: 1
1: 0
2: 1
3: 15
4: 131
1027926606_1027926609 -1 Left 1027926606 7:84473084-84473106 CCATACATAAAATTGCTTCAGAG No data
Right 1027926609 7:84473106-84473128 GAAGTATTGTTTGGGCTTAATGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027926606 Original CRISPR CTCTGAAGCAATTTTATGTA TGG (reversed) Intronic