ID: 1027926901

View in Genome Browser
Species Human (GRCh38)
Location 7:84476747-84476769
Sequence TCAGCTACAATGTAAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027926901 Original CRISPR TCAGCTACAATGTAAGAATC TGG (reversed) Intronic
906659654 1:47573357-47573379 TCAGCCACATTGGAAGAATTAGG + Intergenic
908285863 1:62599794-62599816 TAATCTACAATGTAAACATCTGG + Intronic
908501585 1:64748358-64748380 GGAGCTAAAATGTAAGAAACAGG - Intronic
910388199 1:86707070-86707092 TCCGCTACAATGTAAGCTTCAGG - Intronic
912181822 1:107228054-107228076 TCAAGTACTATGTAAGTATCAGG + Intronic
913716728 1:121542519-121542541 TAAGGCACAATGTAAGATTCGGG + Intergenic
916622279 1:166512142-166512164 ACAGTTACAAAGAAAGAATCGGG - Intergenic
918409358 1:184242620-184242642 TTAGCCACAAAGTAAGTATCTGG - Intergenic
920969149 1:210727731-210727753 TCAGCTAACATGCAAGAACCAGG + Intronic
923108746 1:230874338-230874360 TCAGATAAAATGTGAGAATATGG - Intergenic
1063605963 10:7523135-7523157 TCGGCTGCAAAGTAAGAATGTGG - Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1065228272 10:23569817-23569839 TAAGCTCCAAAGTTAGAATCAGG - Intergenic
1065820117 10:29517539-29517561 CCAGCTACAGGGTAAGAACCTGG + Intronic
1065952808 10:30667360-30667382 CCAGCTACAAGGTAAGAACCTGG - Intergenic
1067176690 10:43954953-43954975 ACAGCTCCATTATAAGAATCAGG - Intergenic
1068151006 10:53131363-53131385 TCAGGTACAATGTCAGACTCAGG + Intergenic
1068765510 10:60758815-60758837 ACAGCTAAAATATAAGGATCTGG + Intergenic
1071917502 10:90311382-90311404 TCAACTAGAATGTGAGATTCAGG - Intergenic
1076387756 10:130070213-130070235 TCAGTAACAATGGAAGGATCTGG - Intergenic
1077165699 11:1136485-1136507 TCACGTAAAATGTAAGAACCTGG - Intergenic
1077386979 11:2274369-2274391 TCAGCATCAGTGTAAGAAGCCGG - Intergenic
1086049776 11:82576908-82576930 TCAGTTACAATGCGAGAACCTGG - Intergenic
1086770098 11:90751801-90751823 ACAGCTACAAAATAAGAATAAGG + Intergenic
1086820831 11:91433890-91433912 TTAGCCCCAATGTGAGAATCTGG + Intergenic
1087626511 11:100603019-100603041 TCAGTTCCAATGCAAGTATCTGG - Intergenic
1087694689 11:101363207-101363229 TCCTCTACAAAATAAGAATCAGG + Intergenic
1087964733 11:104398624-104398646 TAAGCTACAATCTAAGAAGGAGG - Intergenic
1089842047 11:121426964-121426986 TCTGCTACAATGTCAAATTCTGG + Intergenic
1089934175 11:122346444-122346466 TCAGATACAAAGTGAGAAACTGG + Intergenic
1090567030 11:128006266-128006288 TCAGTCCCAATGCAAGAATCTGG - Intergenic
1091637962 12:2212357-2212379 TCAGATAATATGTAATAATCTGG - Intronic
1093774931 12:23062646-23062668 ACAGCTGCATTGTAAGAAACAGG - Intergenic
1094273899 12:28646517-28646539 TCAGTTCCAATGAGAGAATCTGG + Intergenic
1094811423 12:34142480-34142502 TCAGTCACAATGCAAGAACCTGG - Intergenic
1095838598 12:46666773-46666795 TAAGCTACAATTTAAAAATGTGG + Intergenic
1097928757 12:65160867-65160889 TCAGCTAAAATGTAAGATCTAGG + Intergenic
1101063376 12:100994809-100994831 CCAGCTACAATGTAAGCTCCAGG - Intronic
1106442265 13:29786389-29786411 TAAGCTAGAATGTGTGAATCGGG - Intronic
1107240662 13:38230731-38230753 TCAGTTCCAATGTGAGAACCGGG - Intergenic
1107770450 13:43783927-43783949 TGAGCTACAGTGTGAGTATCAGG + Intronic
1108540216 13:51436300-51436322 TCTGCTAGAATATAAAAATCTGG + Intronic
1110927466 13:81173048-81173070 TGAGGTTCAATGTAAGAATCAGG + Intergenic
1110982556 13:81919654-81919676 CCAGCTCCAAGGGAAGAATCAGG - Intergenic
1113524717 13:110965985-110966007 TCAGCTACATGGAAAGAAACTGG + Intergenic
1114889650 14:26902104-26902126 TCAGCTAAAATATAAGACTCAGG - Intergenic
1115577864 14:34728618-34728640 TCAGCTAGACTGGAAGAATACGG - Intergenic
1116210344 14:41931602-41931624 TCAACTATAATGTGAGAATAAGG + Intergenic
1116758042 14:48973221-48973243 TGAGCTGCAGTGTAAGAAGCAGG + Intergenic
1123672233 15:22670755-22670777 TCATCTACAAATTAAGAAACTGG - Intergenic
1124324280 15:28744046-28744068 TCATCTACAAATTAAGAAACTGG - Intergenic
1124528165 15:30477090-30477112 TCATCTACAAATTAAGAAACTGG - Intergenic
1124770492 15:32530614-32530636 TCATCTACAAATTAAGAAACTGG + Intergenic
1124861052 15:33441805-33441827 ACAGCAACCATGTAAGGATCTGG - Intronic
1128098725 15:64979958-64979980 TCAGCTATAAAGTAACAATCAGG + Intronic
1130318308 15:82816010-82816032 TCATCTACAAATTAAGAAACTGG - Intronic
1135293183 16:21257584-21257606 TCAGCCACAATGTTAGGCTCAGG + Intronic
1137354207 16:47743676-47743698 TCAGCAAAAATGTCAGAATAAGG - Intergenic
1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG + Intronic
1144120711 17:12150214-12150236 TCAGTCACAATGTGAGAACCTGG - Intergenic
1147942336 17:44057933-44057955 TTAGCTACAATAAAAAAATCTGG + Intronic
1148727591 17:49805551-49805573 TCCACTACAATGTAAGAACAAGG - Intronic
1153001843 18:462977-462999 TCAGCAACAATGGAAGAACAAGG + Intronic
1153059528 18:980991-981013 TCAGGCACAATGTTAGACTCAGG + Intergenic
1156303292 18:35854083-35854105 ACAGCCACAATGTAACAATAGGG - Intergenic
1156361490 18:36388226-36388248 TCTGGTTCAATTTAAGAATCAGG - Intronic
1157167359 18:45370299-45370321 TCAGCCACAAGGGAAGATTCAGG + Intronic
1158236024 18:55314992-55315014 ACAGCTACAATGGAAGCAGCTGG + Intronic
1165688960 19:37847835-37847857 GCAACTACACTGTAAGAAACTGG + Intergenic
926640000 2:15224919-15224941 TCAGCTCCCATGAAACAATCGGG + Intronic
928849931 2:35733946-35733968 TCAGTTCCAATGTCAGAACCTGG - Intergenic
932829686 2:74977128-74977150 TCAGATACAATGAAGAAATCAGG - Intergenic
934536319 2:95137064-95137086 ACAGCTACAATCTAAGAAGTAGG - Intronic
936875955 2:117189571-117189593 TCAGCTACCATGTGAGAAAATGG + Intergenic
938883176 2:135613470-135613492 TAAGATACAATTTAAGATTCAGG - Intronic
948212431 2:236204592-236204614 GTAGCTACAATGTAAGCAGCTGG - Intronic
1168887838 20:1272545-1272567 TCAGCTACATTTTAAAAATTAGG - Intronic
1177117506 21:17104396-17104418 TCAGTCCCAATGCAAGAATCTGG - Intergenic
1177343554 21:19837379-19837401 TCAACTAAGATGTAAGATTCAGG + Intergenic
1178591116 21:33911223-33911245 TCAGTTACAATGTAGGCTTCTGG + Intronic
950833666 3:15899479-15899501 CCAGCAACCATGTAAGAATTTGG - Intergenic
951244936 3:20330219-20330241 TCAGCTACAGTGAAGGAACCTGG - Intergenic
952253824 3:31678646-31678668 TCTACTCCAATTTAAGAATCTGG + Intronic
956145456 3:66187000-66187022 TCAGCTTGAGTGTCAGAATCAGG - Intronic
956624602 3:71254760-71254782 TCAGCTACAGTGAAAGACACAGG - Intronic
958595889 3:96222188-96222210 TTAGCATCAATGTAAGAGTCTGG - Intergenic
960130452 3:114050548-114050570 TGAGCTACAAGGGAAGGATCTGG + Intronic
960722637 3:120639941-120639963 TCAGATGCCATGTAAGAGTCTGG + Intronic
966485660 3:180466490-180466512 TCACCTTCATTGTAAGAATTGGG - Intergenic
967487407 3:190049328-190049350 TGAGCTACAATTTAAGCATCTGG - Intronic
967670662 3:192231298-192231320 TAAGCTAAAATTTAAAAATCAGG + Intronic
968315933 3:197725551-197725573 TCAGCAACATAGTAAGACTCTGG - Intronic
972021899 4:34326337-34326359 TCAGTTCCAATGTGAGAAACTGG - Intergenic
973011222 4:45076602-45076624 AGAGCTACAATGTAAGAACTAGG + Intergenic
976160575 4:82194200-82194222 GTAGCTACAATGTAAGATTATGG - Intergenic
978366546 4:107989312-107989334 TGAGTTACAATGCAAAAATCAGG - Intergenic
984071257 4:175116088-175116110 TCAGCTGCATGGGAAGAATCTGG + Intergenic
985679322 5:1247659-1247681 TCAGTTACAATGGAAGAGGCTGG - Intergenic
989961828 5:50425234-50425256 TAAGGCACAATGTAAGATTCGGG - Intronic
990515208 5:56524830-56524852 TCAGCAACTCAGTAAGAATCAGG - Intronic
990614622 5:57494835-57494857 CCAGCCACAATGTAAGAGCCTGG - Intergenic
992521794 5:77560341-77560363 TCAGCTACAGTGTTAGAGTTAGG + Intronic
993075464 5:83225251-83225273 ACAGCTACAACTTAAGAGTCTGG - Intronic
993916205 5:93744831-93744853 TAGATTACAATGTAAGAATCAGG + Intronic
994924961 5:106103478-106103500 TCAGCTACAATATAAGCAATAGG + Intergenic
995101072 5:108306435-108306457 TCAGGTACAAGGTTAGAAACCGG - Intronic
995258405 5:110073276-110073298 TCAGTCCCAATGCAAGAATCTGG + Intergenic
996569846 5:124921239-124921261 TCAGAGAGAAAGTAAGAATCTGG + Intergenic
998907035 5:146916673-146916695 TCAACTACATAGCAAGAATCTGG - Intronic
998907305 5:146919742-146919764 TCAACTACATAGCAAGAATCTGG - Intronic
1003265658 6:4563260-4563282 TCAGCTACAATTCTAGACTCTGG + Intergenic
1003328273 6:5109142-5109164 TGAGCTACAAGGTAGGAATGGGG + Exonic
1003853884 6:10252724-10252746 TGAGCTCCATTCTAAGAATCTGG + Intergenic
1003902619 6:10668842-10668864 TCAGCCCCAATGCAAGAACCTGG + Intergenic
1004978093 6:20990933-20990955 TCAACTACAATGTAAGTATTTGG + Intronic
1008428817 6:51390854-51390876 TCAGCTACAGTGAGACAATCTGG + Intergenic
1008708930 6:54199835-54199857 ACATATACAATGTAAAAATCAGG + Intronic
1010542117 6:77104271-77104293 TCAGCTACAATGTCATCATGAGG - Intergenic
1011296903 6:85835707-85835729 ATGGCTACAATATAAGAATCAGG + Intergenic
1011659365 6:89581071-89581093 TCAGGAACAATGTAAGAAGCAGG - Intronic
1012572265 6:100743271-100743293 TCAGTCACAATGTGAGAACCTGG + Intronic
1012794756 6:103745086-103745108 TAAGCTACAATAGAAAAATCAGG - Intergenic
1015667066 6:135643740-135643762 TCACAAACAATGTAAGAACCTGG - Intergenic
1015929857 6:138348272-138348294 TCAGCTACAATTTTTGGATCAGG - Intergenic
1019828664 7:3303970-3303992 CTAGCTACAATGTAATAATATGG - Intronic
1020868153 7:13591527-13591549 TCAGTTCCAATGTGAGAACCTGG + Intergenic
1021836884 7:24685783-24685805 TCAGCTGAAATGTAAGTATTAGG + Intronic
1026129405 7:67607607-67607629 TCAAATACAATGAAAGACTCAGG + Intergenic
1027736225 7:81936090-81936112 TCAACTTGGATGTAAGAATCTGG + Intergenic
1027926901 7:84476747-84476769 TCAGCTACAATGTAAGAATCTGG - Intronic
1028980763 7:96965629-96965651 TCAGCTAGGATGAAAGAATTAGG - Intergenic
1029241042 7:99162805-99162827 TCAACTACAATCTACGAATAGGG + Intergenic
1030413752 7:109213795-109213817 TCAGTTCCAATGTGAGAATATGG + Intergenic
1030485556 7:110162520-110162542 TAAGCTACAATCTAAAAAACAGG - Intergenic
1030951980 7:115802171-115802193 ATAGCTACAATGTATGAATTTGG - Intergenic
1031639691 7:124146028-124146050 TCATCTAGAATGTAAAGATCTGG - Intergenic
1032703486 7:134402630-134402652 TCTGCTACTATATAAGAAACAGG - Intergenic
1034625150 7:152486895-152486917 TAAGTTACCATGTAATAATCTGG - Intergenic
1037053473 8:14406470-14406492 CCAGCTACGATTTAAGCATCTGG - Intronic
1041618955 8:59942929-59942951 TCAGCTACACTGTAAGTAACTGG + Intergenic
1045346055 8:101294700-101294722 GCTGCTGCAATGTAAGATTCAGG - Intergenic
1045416189 8:101970193-101970215 TTTGCTACATTCTAAGAATCTGG - Intronic
1047175128 8:122533483-122533505 TCAGAGACTATGTAAGAAACTGG - Intergenic
1054701973 9:68421792-68421814 CCATCTACAAAGTAAGCATCTGG - Intronic
1057254699 9:93535919-93535941 TCAGCTAAAATCTAATAAACAGG - Intronic
1057742252 9:97722039-97722061 TGGGTTACAAGGTAAGAATCAGG + Intergenic
1186964557 X:14773030-14773052 TCAGTTCCAATGCAAGAACCTGG + Intergenic
1191832581 X:65430899-65430921 TCAGTCCCAATGCAAGAATCAGG + Intronic
1193457959 X:81754682-81754704 TCAGCCCCAATGTGAGAACCTGG - Intergenic
1194580429 X:95665272-95665294 TCAGTCCCAATGTGAGAATCTGG - Intergenic
1198686969 X:139237568-139237590 TCAGCCCCAATGCAAGAACCTGG - Intergenic
1199303139 X:146236113-146236135 TCAGCTACATTGAAAGAATGGGG + Intergenic