ID: 1027932575

View in Genome Browser
Species Human (GRCh38)
Location 7:84556231-84556253
Sequence CTGGCCAAACTGATTTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027932573_1027932575 7 Left 1027932573 7:84556201-84556223 CCACAAAGATTTGGGAGATCAAC No data
Right 1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027932575 Original CRISPR CTGGCCAAACTGATTTAAGA AGG Intergenic
No off target data available for this crispr