ID: 1027932657

View in Genome Browser
Species Human (GRCh38)
Location 7:84558262-84558284
Sequence ATATATATGCTACTGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027932657_1027932660 25 Left 1027932657 7:84558262-84558284 CCACCCAACAGTAGCATATATAT No data
Right 1027932660 7:84558310-84558332 GTGTACACAAAACATTTCTCAGG No data
1027932657_1027932661 26 Left 1027932657 7:84558262-84558284 CCACCCAACAGTAGCATATATAT No data
Right 1027932661 7:84558311-84558333 TGTACACAAAACATTTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027932657 Original CRISPR ATATATATGCTACTGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr